Description :
From Genome Similarity Track
Location :
Scaffold_2046:2- 3328
Sequence
3326 bases(100 bases per row)
TTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCGATAACGCCCTCTATG
GATTCACCCGAATACCGGAACCCAAAAGGGTTGGATCCGGGGAAGATCGTACGGAAGTAGATCCATTTGAGGCAGGGGAGCCAGGGGATCCTGGAACCCC
GTCCGTGTTAGAACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGT
ACTAAGTGGAATCTCTCCATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGA
ATCCTAAGGACCTGTCTTCGTTAGCCGATTTGTCCTTCCCGCAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCAT
CGAGGATTACGCCCTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATAAAAATCCAACAAGCT
CTGGCCCGGGAGATGTCGGATCCACGAAGGAATCCAAGTGGTACGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGACCAACGGAGAG
AGGATCCAGGCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGAT
CGCGACCACGCCTATCCTCCGTCATTTCGATCCAGAACGTCAACCTACGGTTATAGTTTATACCAGCGACTGGGCAGTCTCAGCAGCTCTGGTGCAAGAA
CATGAGGGGATCTGCTATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGC
GCGTGTTGGATCTGAATTACAACCTGCTAGTGGGAAGACCCATCCGGATCCTGACTCGACACTCCACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACA
AGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACGCTGGAGATTGTGAAGTGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCG
AGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAGGATCGCCCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGG
TAGATGAGGATCTATACGTCCTGAGTTTCGATGGATCCGCACGTGTACGACGCGGAGGAGGAGCATACAGTGCAATACTGTGGAGACTGCCCGGATGGGA
AGTTGTACGGCCAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAGGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGGGACAAGATC
CGAAAAGGTTGGTGATTTGTGGAGATTCAAATTTAGTAATCAGACAGGTGCGAGGCGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAA
AGTGATGATCCACCTGCGTGGTTGGATGAATCACGATTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGTGCCGCTTTACGG
GATCAATGTGGTGTCGAAGTGGAGAGAGAGGCCGAGCGTCAGGATCTCGTTACGTTGAACCGACTAGACGAATGGTGGTAGTGGGATCCGGGAAAAGGAC
AGTCCAGGTGATGGCCGTCACTAGGTACAGAGGAAGGATTGGATTCAACCCCCAAATTCTCGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATC
CTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTACCGCA
TTATCGCTACGGATTACGCGGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGACTGGT
GATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAA
TGTTTTCACTGGAGGGGACTTTTCAAGAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGT
CACCTGAGAATATCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAGGTCATTCAAAGGATAGCCATGGATCATCTC
CCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGAGGACCTGTTTACCGGATACGTGGTAGCCAAAGCTAGTGCGTCTAGAACTG
CGCAGACCATTGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTT
CTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGTCGAGCGCATGGTACAGACGATC
ACGAGAGCACTCAAGATGTACGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGGCTCCCCTTCGCGATGAACACCGCCCAAGACAGGA
TCCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGGATCCTAAATCCACCCTAGAAGCGGCCATTCCGGTATGTAGCACCAAGAAGAGAAACCGAGA
TCCAAGGCGATGGTGATACGAAGTCCAGAAATACTACCAGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGATCGAGCGGATCGA
CACAACGAAGACGCCCGTCCACATCTAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGATACGCCCGCAAATTGGCCCATC
TATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACATGCGGTAAAGCTGGAAACGGCAGGTACCGAATATCGCCTGTTCCCTGTAGTACACGT
ATCCAAGCTGAAGTTGGTCAAAGAATACCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGAATCCGACCGGGTGGATTTCGACGAAGTCCTCCTACCG
GAAGATAGTTGGAATGTGGATCTCGA