Description :
From Genome Similarity Track
Location :
Scaffold_2057:2- 3293
Sequence
3291 bases(100 bases per row)
GATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGCGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCAGATCGAGGC
GTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCG
TCGTGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCA
CGCTTATAACAAGCTGAATAACGCAACGGTGCCGGTCCAAACACCGATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGT
GCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGC
TCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCCTCGTACAGACGTACTTCGA
CGACATTTTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAG
CTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGG
TCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGTTTGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGC
GGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTC
CAAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGGACG
ACACGGCTGGACAGGAACGAGTCATCTCATTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAA
ATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTACGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCAC
CTCTCCCAACGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATATAACTTCCGCGTCGAGTACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCT
CTAGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCC
TATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTC
CTCTATTGTCGGGTAGAGCCCACTGATCCTCCACGGGTGGTTGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCT
CCAGCGGCCACTTGGGCCGCGAGAAGACCTTCTGTCGGTCTCTCAGGCTTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATACGTGAAGACATGT
GAGACATGTCAGCGGGTCAAACTCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGAACCGGCTGACTATTGAAAGTCGATGAGTCTTGACTTCA
GATTTGGGCTTCCCGCCGACGGACACGGCAACACTGGAATTTTGGTGTTTGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCGGTTCCCGTCACTGT
TACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGTGTGTTCCGCTATCTTGGTCTCCCGGAGACGATTATCTCGGACCGAGACCCGCGGTTCACGGCT
GCGTTTTGGAAAACGCTGTCTCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGATCATCCACAGACAGACGGCCAGACAGAGCGCGTCAATCGAG
GGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGC
GTCCACGGGGTTCAAGCCGTTCTACTTGAACGGATTCCGTCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGA
GAGGCTCGGAAAGCCCTTTCCTCCCAGGCCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAAGTGAAATTCTTTATGGATACCAAGCTGAGCATTGTCA
GCAGGGTCCGCGATGCCATGGCAGTGGCCCAGGATAGACAAAAGGAGTACTCGGACAAACATGGAAGAGGAAACTTAAGTGTATTTAAAGAAGGAGACTT
AGTGTTACTAGACACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGAACCATTTGCAGCCCTGGCC
AGACATGGTGCGTCGTACACCATCGACCTGCCCAAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGTACTTTGATCCGCAGGGTG
TTGCTGACTCGCAGACCCACCTGGGCCCAAGCTGCCTAAAGCGAGGGCCGGTCCACAGAGCTGGAACAGGGGGCTCAGAGCGGGCTTTCAAACCTGGTTT
CGGGAGGGGCAAAAACTGGCGTTCAAGACCCTTACGCCGCGAGGGGGCTCCCTTAGGAAGAGGACCGCGGAGACCTTAGGCGGGTTTTAGGAGGAGTACG
CCGAGTACGCACCATACGCGTACGTCTAAAGTGCGTCGAAGGCGGCTCCCGGCGCGGCAACGGAGCCTCGATCCGTCGGATCACGCGGAAGGCCTCGTCC
AAATCGGACGAAGAGGCCCGGCGATCCTCCCGCAGATGAAGGCTCGCGACCTCTCGCTCCAACAGCTCCAGGCGGCCCGCAAGACGAGCAAACTCGCCCT
GATTCCCGGCCTGAGTGGCAGCATCGCCGCCAGTCCCAAGGCCAAGTGCGATCTCAAGCACGAGAACTCGCTGACGGAGGCGGTCAACCTC