Description :
From Genome Similarity Track
Location :
Scaffold_1956:2- 3281
Transcript NameFunction/comments
Phypl_g14451hypothetical protein PHYSODRAFT_332764
Phypl_g14452hypothetical protein

Sequence
3279 bases(100 bases per row)
CCTCGTGTGCTTGGTGGCACCATCGGTTGAGCTTCATATGCGGGGCTCTTGGGCGTACCATGTGAACCAGACGTCCTTCaggtttgttgctgctgctgca
cggcgtcgctttgctggtggctcaTTACTTGTGTCTCACCTGTTTCGTTTGTGTCTGGTGTCTATTGCGGCTTGTTGTAGACTTTAGCCTCCATCGTAGA
CAGCCGAGCGTCGAGCTTGTGGTTGACCTGAATTAACTGTTCCATCAAGGCGGCTCGGTGAAGAAACGTTGGGTGCTTGGTGATATCGCTCGTGCTGTCA
TGGGACTTGGTGTTGTCGGCTTGAGGAGTTGTGCTCATATAACAGGCCAGGTGCGAAGACCAAGCTAGAAGCTCGTTGATGGTGTGGCCTTTTTCAATGG
CACACGCTTCAAGACACTCGACAGCAAGTCCGCccgcctcgagctgcttcagcgatgGATAGGAATGTCAAGAGAGTATCAAGCATCCTTCCATTCACGT
TGTACTGCGCTGTCTTGACTCCGTAGGACGAGTTGAAGAGCGTCGATGCGACGGTTCGAATCTTCGTCTGGGTGTCGGAGTCGAACCAATCCAACGACAA
GAGAGGAACTACTTGATCAGGACCCCGGCCACTCAAGACGCGAGCGACCTAGTGATCTTCGGCCGGTGTGTTGAAGACGTACGCGAAGGATTTGTTCATC
GCTGTCATATTCCAGGCTCCCCGGTCGAAGATCCACTTCACGCACATGCCTGCTCCATTGGCGAAAGGAATGCGATGTGAGGCGCTCGGTCACACCAGCC
TTTTTCGCGACTCTCTCCAGGACGCGGTTGACGTAGCTGTGGATGCTCGGGGCAGAGTTAATGGTCTTCCCTTCATCCGAGCGAGTTGCTTGTGCCGATA
CAGTAGGCCCTGGGTGGTCGATCAAGTCGTCGGAGAAGCTTGGGTCGCCAGTGCAAGCGCAATCGGGAACAGTGGACACGCGGTGAAATCGTCGTCAGGA
AACGGCGAGAGGCCCTGTTCTTCGGCAGTCTTGATCCGCATGAAGcgcacgaagaaggcgtcgcACGCGCCGATGGACAGGTTGGCCTTGCGAAGCAGCG
TAAGGTCCGACGCACGCCCGACAAGGAACCACAGTaagctcagcagcacggcgtcctgATAGTCTGCGGAGGTAACAGCAGCCGAGAAGAGATACACCAT
TatctgcttgagcgcgttcTTCGTGCACGCAAGAGCCTTGTTAATGAAGGCGCCCGACTCTCTCTTCAACCAATAACGTTCCAGTGTTTGCcacttcttg
agcagcgtctcgtcAATGGCCGCTCGATGCTGAGGAAACTGGTCCAACAGCCAGTTCTTGGCCTGTCGGTAGTACTGCATGACCGAGTTTCGAGCCAATA
GCTTGCCCTTACGGCCCTTCTTGAAGGCGAGCTGCATGCCGAACTTGTCCACCACAGCTTCCAGGACAATCGCGgcacgctcgcgctgcatgaCCAGTTC
CAGGTACTCCCAACTgacgtcttcctcctcgaggAACTTCAGAAACGAGCGCGCTGCGGACTCGCGAGCAAGCTTAGTTTTTACAGGTGTGAGGTCGTTC
AGGCTCATCTTGCGTCGGAGGTGTCAGAGCTTGGGTATTATTCGAGAAATTTGCGAATGACTTGCCATCTGTAGAGAGATAATAACAACTTCAGTGCTCC
CTCCGACCCGATACGTCGGAGGTGTGGCTGTCAGGCAGTCACCAATCCGCGACCTATCTGATTGGTCAACATTGTTTGCGTAGATCAATTTGATTCGCTA
AAAGCCGAGATATTACCAAGTAATACAATCTATTGGTCGATAATATCAAGAGTAAGTTCAAGTATTGTCGGAGATGTGACGATATTCATCCATAAAATCA
GTTcgcaattcgcgccgtttggcTCAAGAGGCTTctgggtacatctccgaaggGCCGGCGCAGCCGAATCTTTCTTCGCTCGGACGCGAGCTCCCCCCGC
GTGGGGCCGAGGCTGGGAAGAGGAGCTGCATGTACCTGGTGAATACCACCAAGTTACTACTAGCAGCGGGATGCGGGCCTGGTGACCCCGCGGACCTCTA
GTCAAGATCACCACCAAGTCGCGACGGGCCTGGCGGACCCGTCGCNNNNNNNNNNTTCCCCTCCCCAGAGTGCAACACAGCAGTCCAGATACATATTCGC
CTTGGCGTGAAGACCCCGATCGATAGAACAAGGCCTCAGAGAGGACCCCTGTAACGGATATGGTACACCCACCCACCAcatgcaagtcgaaggaaaaCAG
ACTTTCAAAAGACCGAAGTGAAAGCTTCCGAGGAAGACAGTCTGAttgtgacgggctgtcacgCAAGCACGctgcacagaggaagtgtgtgcttcgaagt
ttatacaaactcccgGTGAACGCcagttcacttagtccctggcctgaaggggactggtaccaaaGATAAGGTAAAAGTAAGATTGAATATATTTAAGAAA
GACACCAGTTTGccctgcaatacaaactgtACAACACCTTTAGTAAAACCTATATAAATACCTCAGAGCCATTGTCACTGTTCTCGTTTCAGTGACttat
gtagccatgtagaaagtgatacAATCACTTTCGGGAGGGTAACCCATGATACCCGAATGTAGCCCCGTTACATCCTCCCCACTTAGGTTCGATTTACAta
ttgaccaatcagagTAGAGGTCGTTGAAGCGCTCACACTTTGCTCTCACAGTCGAATTACATCGACGAGCCGCACGAACACCGCGCGACTTCGAGAGAAC
TGAGGCCACTTGCGCGCTCCTCCAAGCCCCCTCGCTAGGTCACCACTCGACCCCGCAGGCATGCCCCATAAGGGAAGCCCAGATGGCTCCTCGGCGACCA
CCAGATCCAAGCCCAAGGctgcgaagccgaagacTAAACGAGCTAAGCCTCGCGGCAAAGCTCAGGCATTGGATGATGCcgttgtcgacgctgctgcaac
gcttGCAGCGTCTGGCGCGACCGCCACGACGAAGGACTCTAGNTTTCGTTGACGCGAAGGATAAGGGCCAGAGCCCCAAAGAGTCTGGTGCAGCGACTCA
CCATCCCACACTGGAAGAGGGCAAGGCGCCGGCACAGGGCGCTAAGGCCAAACCCGCTGAGGTCAAGCACGCACGCGTTTCGaggcgtgctgcttctcgg
tCTCCTGTCAAGGACGAATTCGAGGAGTTCAAGCTCAGTGGTCAGACTCTGTGCCACAAGAGCGGGCCTAATGACTCTC