Description :
From Genome Similarity Track
Location :
Scaffold_2562:2- 3214
Transcript NameFunction/comments
Phypl_g15206hypothetical protein

Sequence
3212 bases(100 bases per row)
ATCATCGCTTGCACTGTTCCTTGGGCGTCCCAGCCATGGACCAGGTAGAAGGGGGTCTCAAGTCGGGTAGCATCGTAGGACGTGTTAAGTGCCcacatga
gcttctcggcgagtTCGTCCCAATCACTTTGGTCGACTGTTTGCACATAGGCTCGGACACTCCGGATGACTGTCTGCACGGACCTCTCTTGTTGGCCGTT
GGCTTGGGGTCGATATGACAGGGTCGCACGTTGACGACTCCCGAGCATCTCCCTGAAGTGCTTGAAGACGCGTCCCATGGATCAGGGGTCTTTGTCGGGA
CGAATCATCTCACTGGCGCCGAATCGCCGGAACACACACTCCTCGTAGGCTTCGGCTACATCTTGAGCAGATGTGCGCCCCATGGATTTACACACGACGA
AACCCGAAAAAGCGCACTGAAAGAGGAGCAGAGCTTCGTTACCCCGGGCTGTCCGAGGAAGAGGGATGACGAAATCCATGGAGACAACCTAGAAGAGCCG
GATCGCTAATATGTTCCCCGGGGAAGGTCCCGGGTTCCGCGGCAGGCCTTTAGCGGTCACGCAGTCCACGCATTCCTTGACAAATCGTTCGGCGGACCTG
AACATGCCTATCCAGTAGAATCCCGACGCAATCTCTCATACGTCCTGATGATCCCTTGGTGGGCTGCTTGCATGTCAGAATGACAGTGATGCAAGATGTC
GATCTGGAGATCCCGGGGCACGACCAATCTAAGCCGGTCTGCTTCGTTCCGGGGACGTTCGGGGGTGTTCTAACTGACGTAGAACAGCGCATCCCTGTAA
TCCAAGACGAACTGCCCTGCAATCTTGGCTAGGTGTGTCGTCTGCTTCTGTGAGAGCTGTTCCGTCTCTCCTCGGAGGAAGTTCACCAACGgccgcagct
ccgggtcAGATGCTTGGTGAGCGCAGATCCTCCTCCAAAATTCCCTCCTGGCTTCTCCTGAGTCTTCTTCTGGCTGATGGTGCTCACGGTTCCCAGAGTC
GACTGCagtctcttcctcctcctcgtctgactccgtcgtgttcgtggtgtCAGGTGGGGCTtggggcagcgccgccgcctccggaGGATCTTCGTCGGAA
TCTGCCTCGGCTGGTGCGGCTCGGGCCGAGCCCGAGTCGTTACGAACGCGTTCGCTTCCGGGGATTCCACTGGAACACCGCAAGGGCCCCGAGCCATAGC
CACGAAGGCCGACTCCACAAGTGATTTCTCCCTCGGGGCCGGCACTTTCATTAACTTTTCATGGATTCGGTTTAAGCCTTGGAGCAGTTTGATCTCCCCC
GGGTCATCGACTTCTAGGAACGTCTGTTCTTACAGGATTCGTTTGGAGACGTAGTCCGCAGCTGCATTGAAGTCTCGTTTCACATGGACTAGGCGGAGAG
AGCTGAACTTAGCTTGTAGCTCCTCGGTCTCTTGCAGAAGTCGTTGCAGGTGCGGTTGTGTACACCCAATCACTCCTTGCAATTGCTGAATCGCTAGGCG
TGAGTCTCCGACTACCACTAGATCCTTGACGTATTTCTCCAGGGCCAAGAGCATTCCCTTGATCATTCCTGCACATTCTGCTTCGTTcaccttcgccttc
gccagGAAGTGTCCTTGGGCTGATACGATCTCCCAGGCTGGGAGTTTCCACAGGATGCATGCGGCACCCCCGGATCCATCTCTCTTGGCGGCTCCATCGA
AACTCAACAGGTGGCCTACGTGGTCATTGGAGAGCATCTCCAGGCTAACTGGCGGTGTCTTGATCCGGGATCCCTTGGAGGGAATCAGTTCTTCTGCTAT
CTCGTCCAACTGTTCCCGGGGCGTGATCCCTGCACCCAAGATCGCTGCGAGACCGTCTTCATCACGTTCGACTCGCCGGATGTCTAAATCCCAGGGCGGC
AAGTTGACGGCCCACTTCAGACATCTCCCGTCCACAGTCTTCGACTTGAACAGCCATCCCAGGACCGAGTATCGCGTGTAAACCCGTatcgtcttcttgg
agcaTCCCGCGATCACGGTGTGGTACGTGTTGAGGACTCGCAGCAAAGCGATGACTTCTTTTTCAGCCGGGTGATATCTCAACTCAGCGTCTTGGAGAAC
GCGACCCACGAATCGTACAGGTCGCACGACACCATTGTAGTCTTGCCCCAGGCCGGCACTGATGGCCCACTTGTTAGCATGCAGGATGATGACGTACTGC
CTCTCGGGGTCCGGGTGCTGTAACAACGGGGTCGACACCAGACgttccttcagcagcttgaNGCAGGTCCAGGACTTTCGTGGCGAGCTTGGGAGACGTG
CGGATTCCATCCGAGCTGATATCATGTCCGAGGTACTTGCAGTTCTTCACACCAAACTCGCTCTTCGGGAGGCTGACAGAGATGTTCCAGTATCGCAGAC
GGTATAACAGAGCATCCAGGGTCTTGCACAAGTCGTCCCAGGACGGGGCTCCGTAGATAATGTCGTCGATGTATGAACTCCGGAACAGAACAGGTCCCAT
CTGCTCCGGGGAAACCCGGTTCTGATGGAACACCGTATCCGTGCCAGTTCGAGAGACAACCGCCCCCGGGGGCTCCGTTCCCTGGGATGCTTGGGAGTCG
ACAGCTTGGTCTAGTCCGAGGAACTTCAACACGTCGGGATCCACCAGCTTTTCCTCGTCCGGTGATAGCTGGACGAAACCCCAGAGACAAttgtcgagga
gctgctggtaaATCAGCGGCGCATTCTTCAGACCGAACGGCATACGCTTCGACTGAAAGTGTCCGAGGGGACAGATGAAGGCCGAGATCAGCTTGGCACG
GGCAGTCATGGGTACCGCCCAGAAACCACTTGCCATGTCCAAGGTCATAAACCACATCGTTGCCGAGAAATGGCTCAGGTACTCGTCGATCAGCGACAGC
GGATAGTTCATCAGCTTGATCAGCTGACTCACCAGTCGATAGTCGATGCACAAACGGATATccttgccgttcttcttcatcacgatGACGATCGGCGATG
CCCAGGCTGACTCTGAGTACTCGATCAAACCTGTCTCCAGGagccgcttgagcagctcgtagaCCTTGGGTCAAAAATCCCCAGGAATCCGCCGGGCGCG
CTGGGAGATCGGCTTCGagtcgccgacgtcgaggtCACAAACCACTCCTCGGGCAGGCGACGGCAAGGCGTTGCCTTCACCGAGGAAGATCTTCTTGTGA
CGCCGCAGGATG