Description :
From Genome Similarity Track
Location :
Scaffold_774:2- 3190
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_774-snap-gene-0.5Chromodomain-helicase-DNA-binding protein

Sequence
3188 bases(100 bases per row)
GGCACGCCGCTGCAGAACAACACTCAGGAACTGTGGGTGCTCCTGAACTACCTAGAGCCTGTCAAGTTTGCGAGTATGGACGATTTCAACGACAAGTTCG
GCAAGCTTCAGTCGCAAGAGCAAGTCGTCGAGCTTCAAAAACTGCTCACGCCGTACCTTTTGCGGCGCGTCAAGGAAGATGTCGAGAAAAGCATCCCGCC
CAAAGAAGAGACGATCATCTCGGTGGAACTTACCACTCTCCAGAAGCAGTACTACCGTGCGATTTACGACAAGAACAAGAGCTTTCTGTACCGTGGCGCG
AAGAACTCGTTACCGACGCTGAACAATATTCAGCTTCAACTGCGCAAGTGTTGCAATCACCCGTTCTTGATCAAAGGTGTGGAAGAACGAGAACTGGAAG
AGCTCGGTGACAATCCGAATGTAGAAGCGGTAAATGAGAAGACTGTGCAGTGCTCCGGCAAAATGGTCCTCGTGTCGAAGCTGCTGCCCAAGCTCAAGCG
AGAGGGCCACAAAGTGTTGATCTTCAGCCAGTTTCTCAAGCAATTGGATCTCCTGGAGCGGTACTGCGAGGCCAACAATTTTGGTTTCGAGCGCTTGGAT
GGAACCACCAGTGGTAGTGTTCGACAGAACGCCATCGATCGATTTTCGCGGCCCAACTCCAAGACGTGCGTCTTCTTGCTCAGTACCAAGGCCGGTGGTG
TTGGGATCAACCTCATCGCCGCCGACACCGTCATCATTTTCGACAGTGATTGGAATCCGCAGAATGATCTCCAAGCGCAGGCACGGTGCCATCGTATCGG
CCAGAAGAAAGCTGTGCAGATCTACCGCCTGGTGACTCGTAATACGTATGAGAACGAGATGTTTGATCGTGCATCGCGCAAGCTCGGATTGGAACAGGCT
GTGCTGGGAACGGCAGCGTTCAACGAGGCAGCCGAGCAAATGGAGAAGCCATCCGCTGAGCAACTCGTGGAGCTATTGAAGCGCGGTGCTTACGCACTCA
TGGAAGACGATGACAAGGCCTCCAAGCAGTTTGCTGAACGAGACATAGAAACGATTCTGAAAGAGAATGCCCGTGTGCGTGTGGTGGGACCCAGCGGCGA
GACCGGTGATGATGGCGCGCACCAAGTCAAGCATAAGTCTCCACAAAAGAGCCGTAAGCGCAAGTCATTGGGTGGTATCGCGTTTGATCGTTCGTCGTTC
GTGGCGGATGGGTCGTCGGATTTGTCCGTTGACGATCCCAACTTCTGGGAGAAGGTTATGCCAGGCGCCATGTCGGTCGAGATGCTGAGTGCAAAGCTCG
AAGATGGCAGTGTGTTGGCCTCGCGGCAGTCCAAGATCAAGTTTATCAGCAACCTCGATATCTCTTTGGGCGAACTCGTCAATGATCTCCGCAATGCCAA
CGATGGCGACGATGGTGCGTCTGCGCGGTCGTCATTAAATATTGAGCACGAGTACACCATTGCGATGAAAGTACTGCACCGTATCACGACCAAGCACAAG
GACGATTTCTCCAACGATCAAGTGGATCTTGTCAAGAGTTACTTGACGAAGCTCGAAAAGTCTCGTGTGCGAAGCTGTCGCATCACACCGGCCAAGAAGG
AGTTGACCAACTTCGACGATACGCCGGTAAAGAAGAAAGCAGGCAAACCCGTCAGCAATGGTGCCGGGCAAGTGTTGAGCGATGAAGAGATCGAGATCAG
TTCGGATGATGACGATGATGAAGATGGTGGAAAGAAGTCAAAGAATGGGCGAAAAAAGAAGTCGAAAGCACTATCTCAACGCGATATGATCAACGGAGCC
AAGTCGTCAAATCCGTCAAAGAAGCGGAAGACCCTTTCTACGCTGGTCTTGGACAACGGCGCCGGCATGTTCCCGTCCGGCGCGATCAACGACAGCGACG
ACTTGTGCACGCTATGTGGGGACGGTGGCCTGATTCTGCTGTGCGACGGCCCGTGCCATCGCTCGTTTCACCTGGAGTGCATCGGCATGGACACCGAACC
TGACGATGAGCAGTGGCTCTGTCCCGACTGTTCGGCTGGCCGCCACATGTGTCTGATCTGCAAGCAAGTCGGCGAAATGGGCACCGAGTTTGGAGTTGTG
CAGTGTTCGGTGGCCAAGTGCGGTCGCTTTTACCACCGAAACTGTTTGACAAAGCACCCACGCGTAGAATGGGTCGGAGCGAAGCGATTCCGGTGCCCGA
GCCACTATTGCCATGGGTGCCCACAGGATGTGCAGCTTAAGCAGGCTGCCGCTGCGGCGAAGAATGCCAGCAAGAAGAAGCAAGCCGTCAAGGTGGATCC
GGTGATTGGCTGCATCCATTGTGCGCACTCTCTCCACCCGCGGTGCATCAAGGCGACGGACCAGTATATTCGCCTCTCACCGAGCTTGATGATTTGTGCC
AACCATCTTCGTCCAAAAAAGGCGTCCAAGCAAGCGAACGGTGATGGGATCAGTGCTGATGCGAAAGAGCCGGCACCGGCCACGAAGAAAGCGAAGCCTG
AGACAGCGTCCTCGAGATCGGCCGAAACGAGAAAAGAACCGTCGTCGACAAAGACCAAGAAGCTGAAAGCTCGAGCCCGAGATGAGGAAGATGACGAGGA
GGCCGAAACGGCAAGTGCGAAGAAGAAGGCAAAGGTCACCCCCGCTGCTCCAGCGGTCAAGATCTGCGCGTTGTGTCGGAGAGATGAGCAAACCAAGGGT
GGCACGCTGCCCGTAGAGGGCGTGTTTATCGAAGCGCCCGTGCGTATCCACAACCAGGACAAGACGTCCGAGATGGTGTATCTCCACTTGAACTGTGCGT
TGCACTCTCCAGAGGTATTTGTCAAGCCCGATGGGACTTTTTGCAACCTCGCGCGTGCGGTCAAGCGAGGTCGCCAGCTTGCGTGCAGCCGGTGCAAAGA
ACGTGGCGCCACGGTGGGCTGCGTCGTGGAAAAGTGTCGATGCAATTACCATTTGCGGTGTGCCATTGCGAGCAAGGGCGAGTTTATCGGGTCTCCATAT
AGTCTCTACTGCAAAGACCATGCCGTAGAGAAGCGAGAGGAACCCAAAAGCTTCTGCGTTTGTGGCACACAAGATCAGGACGACAACTCGCTCTCGCTTG
AATGCGGATCCTGCGAGATGAAGTTCCATGCTAGGTGCGTGAACATGTCAGAACGACAGGCGCTTCGCAAGTCGAAGGAGAAGAGCTG