Description :
From Genome Similarity Track
Location :
Scaffold_2708:2- 3094
Transcript NameFunction/comments
Phyta_totarag14762hypothetical protein

Sequence
3092 bases(100 bases per row)
TGCTGGGGACGCTTGACCTGCGAGAAGTGCGGCAAGAGAGGGCATCCGTCTGaccgctgcttcttcgtgtgcaAGGCGTGCGGGGAAATCCACGATGCCG
GCGAGTGCCCGCTGGAAGAGTTTTACAACTTGATCCGTCAGTGGTTCAACTCCACCAAACACGCAGGCATGCTGCCGGAAACGGCCGAGAAGATGTTAAA
CTAGGACGCTCGCCGGTTTTGAACCCGGTACGAGACGAGTGTTCTAGATATTGCGTCTATGTATATGTCGAAAAACAAGAGGAGCCAACAGTTAGCAAGC
TGATGAGACCAAGCGACAATACATGTGACCTTCATGGAAAACCTACCTTCGCCGTATCTAGGCTTCACAAGATCGATGAATATTCAAGATCGAAGGTGAT
GATGGCTTTGTACATTTCGCCAGGAGAATCGCGTGGTTACTGGAAGTACCACGTGCCTGACACGAAGTTCATGCAAACGAAAGTCATGGGGAAGCGAAAA
AGCAACCATGCTGTTTGACAGTGGTGTCGAGGTACCTATTATCGACACCGCCTTTGCTCGTAAGGTTGGGTGCTACATTGACGAAAGACAAACATTGGAG
CGCGAAGGTGTTGGGAAAACTCTATATATTGCGGAGGGGTGTACCAGACTTAAGATCACTCTCGTCGGATCGTTGATCTACTTTTTCGACGCATGGGTGG
GCCCACCTACCGGTGGTCAAGACGTAATTCTTGGTATGGACTTCATGGTTCCCGCTGGAATTCGCCTTGATCTCGCTGACGGCACGATTTGTCTTCCCGA
TGAAGTGCGTATCCAGCTGTCCGGCAGGCGTCCGCTCTATGGGGATCGCGTTGAGCCGGTGATCTTGAGGGAAGATCTCTACATCGAGGTCGGGAGATCG
TTGGAAGTGAAGCTACATCCGACCAAAACGGAGCGACAGAAGTTGTGGTTGACCCGTGGGGACCGATGGGTGCCTACACTAACGACTAACCCAGGCAAGA
TGCTCTAACTGCAGTTGACAAACGTGAGCAGTCGGAAGTTAGTGCTGGGTTAGAACACGCGTGTCGGGATGTGGCTGGCTGGAGATCGCGTACCACGTTT
ACCGGGATACGTCTCCGTAGGGTCGCGGAAGTACGCCGAATGACAGAACCTCGCGTACCAGGCGACCACcgacgaaggtgacgatATCtaagctgctgca
gaacccCAAGGACCCGTCGTCGAGCGACCGCAGTACAAGATACCCCCGGCGATCTTGCCGCGGCCGCTGAGccagctggtgctggcagtGGTGACTGCag
agagcgacgaggagaggATATACGTCAAATGCGACCGACGGACTCTGCGAACGGACACTCCAAGGGTAGAAGAAAAGCATCGAGATTCCGACTGGTCGCC
AGCTGAGAGAGGGCGCGTCAACTCTGATGAGTGTACCAAGAATCCAGTCGGCGGTGCAGAAAAGGTGATGCATACTGCCGGTTGCAGAGATCAAGATGTG
GATTCACCGGATATCGGAAAGGCAGAAGGATTGCGACAGGACTGCGACTCGCCGCCGGGTGGGAGAGGGGACGCAGATATGTCAGATGAGGATGTGTCGC
ACGTCAACGGTGGCGACAAGGCAAAAGATCCAGTGAGCGATCAAGATCGATGTGCAGAGCCAGGCGTAAATCCAGTGACCCCAGATCATGATCTCGAGGA
GCGTAAACATACACCCACCAAGGATTACTCGGGGAGTAAACATGCGCCCGCGACGGATTACGGGGCATGCACACATTCAAGACCGGTTTATCCTGTCGAA
GATGAGCAAATATGCTTCAAGGAAGGAGGAGAGTTGTTCgctgaagacgtcgaaggGCAGATGGCAGTGTTACCAGAAATTACGGCAACTACCGAGGAAG
TCAAGATCGAAGACATTCAGGTAGGAGATCTCAGCGACAACACGCCGGAGGAAATTGAACGATTACGACAAATCGTCTGGCGTCACCGACATCTCCTAAT
TGGGAGAGGTAACGCCTTACCGCCGGCTGCGAAAGGGGCGATATGCGACATAGACGTGGGAGGTGCTAAACCCGTCTACCAGCTGGTGCGGAAAGTCGCC
CCGCAGTTCCGCGAAAAATTGTTTCAGCTGATCAAGGGCCTGCTGTCTGCGGAGATCATCCGACACTCAACTTCACCCTGGGCCTCGCCGATCGTGatca
tcatcaagaagaacggagTCGACATCAGGCTATGCATCGATTATCGGTTGGTCAACAGCCTGTCGCGACTGATGGTGTACCCCATGCCGCTGATCAACGT
TCTGCTCGACGATCTCAACAAGATGCTTTGGTACTGTTCATTAGACATGACCAGTGGTTTTTGGGTTGTGTCTATGACGGATCGGGCTCGCGCGATCTCA
GCGCTCATTACTCCGTTTGGCCTGTTTGAGTGGAACCAAATGCCCTTCGGATTGTAGAACGCGCCGCAGATCTACCAGAGACGGTTAGATAATGCTCTGT
ACAGTTTCCTCAAGATTACGAATGACCCTGATCGTCCTAGCCAGATCGACTTGTTCAAGGAGGGAGTGCCAGACACGGAGAAGGAATCGTCTGTCATCGG
TCGTCGATCTTATATCGACGATATCCTGGTGACGTCCAATACGTGGGATAAGTTATGTGCCAAGGTTgacaagttgctggacgCATGCGATCAGTGGAAT
TTGTCGATCAGCGTCGCCAAGAGCTTTTGGGGCTTGCGAAAAGTGGACTACCTCGGACATCAAGTATCGATCGAGGGGTTGGAAGCTCACCCGAAGGAcc
tgtcgtcgctgcttgaTCTACCGTTCCCCACGACATTGAGATCGATGCAGTCCTTCTTGGGCAGCCTCAACTATTACAGCCGCTTCATTGAAGATCTAGC
GATCTACGCGTCAATCTTATATGAACTCCGGGAGGCCGAGTTTTACGAGATCTCGAGGAAATCCAAGCGTGATCTGGGAAAGGAAGGCGAGGATCAACCC
AACGAAGCCGGGAAATGGGACCAGGCGGCTGTGGCATTTGCTACCCTGAAGAATAAAATCGCTACAGCACCCATCCTACAACACTTCGACCC