Description :
From Genome Similarity Track
Location :
Scaffold_1199:2- 3084
Transcript NameFunction/comments
Phyke_g11623hypothetical protein

Sequence
3082 bases(100 bases per row)
tcctcatacacgcatacagtgtatgctagaaacagagtggttgtccaccctgtttcatcAGCGATCCAGCAAGAGTAATCTTGAGCCGAGTACGTCCGTC
TGCCATGTATGGGGTTTTACCAACACCTTCACATTCCAACACCTTATCGTCGTCTATGTGACACCCAACCTTACGAGCGAAGGCAGCGTCCAAGATGGAC
ACTTCGGCGCTACTGTCGAGCAGCAGTGTAGCTTTCTCATTGTTGATTTCCCCCACGGCTTTCGCCTGCCGGCATTTCCTATCTGGCACATGATACTACC
AATACACACGCGACTCTCCTCGCAAAATATCCAAGGCCATTGTCACCTCAGATCTCGAATATTCGTCGATCTGATGTAAAATTGACACAGCCGCGGTACG
TTTCCCATGAAGATCACATGTATTGTCGATCGGATTCATCAGCCTGCTTACTTCAGATTTCGATTGCTTCTCGACATATGCATAGATGCAATATCTAGAA
CGCTCGTCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCCCTCCATACTTGGTGGGGTTGTACCACTGACGGATCAAGTTATAGAACTC
TTCCATCGGGCATTGACCGGTGTCGTGAATCTCTCCACATGCCTTGCACACGAAAAGGCATCGATCCGTCGGGTGGCCCTTCTTTCCACATTTCTCACAC
GTTAATCGTTGTCAGCATCTCAGGTTACTGTGTTTGCTCGATCCGAAGTATGAACGACGTCTTGGCGAGGTTCCCTCCTTCGCTGATCCAGTAGGCCGAT
CCGATTGCCGATCCTTGACATTTCGGTTAAGACGTTCCTGATCCGTTTTGGCTTGATCTGTTTCCTTAGCTCGATCTGAGCTCGAGGTTAGGTAGATCTT
ATGCAGATTCCTTTCACCCTCTGATCCATTCAACTCAAGCTCCGAATCGCTTGAAACAGCAGCTGTGCGGATCGTTCGGACTGCTCTCGTGGTTGCGGTT
GGGTTTGCACCTATTGGTGCCTTTGGTCGGGGTTTGATCGAGCCGTACACCGACTTGCTTTGCCTCAACTTCGCACGCTGTCGGGATCGCAGTGTATCCT
CCAGAGCGTCAGCATCGGGAATTCGAAACAGTGCTAGCTGGTTAGCCAGATCACGATCGTCTAGCGTCTCGATGAAGTGATCCACGTGTTCGCGTCGGAC
TTCGGGCGATCCATCCTTGATTTGAAGATGCGCACGCATACCAGCTACGTTCAGCCGATACAAGTATTCCAATGGTGATTCTTCCGATCTCTTTCGAATA
TGATAGTACTGTCTAGCAACAGACACTCCGCGGCCACAGTACTGCATCTGGAAAACCTTAGACGGGTTTTTCCAATTACTCCGTGCCGATCGGCTTAACT
GTCGATACCAGTTTCGCGCCGATCTGGTGAGCAGGTCACCGAACACAAGGCACTTCTCATCATCGGGAGCCTGATCGCGGACGTAGGCGGACTTCAGCTT
GCTGAGCCAGCTCCTAGCGTGGTCCTCATCGTTGTCCTTCCCAGAAAACTCTTTCAGCTCTGACACCGCGGACAGTCTGATCCGTGGAGTCACTGTGGTT
CCACCAGTGGAGGTTTCTGTAGATGCCACGGCAGCTCGGGGCGGACTGCTGACAATGAAATCGTCTGGGTCATACTCGCTCACGTGTGATACACCGCGAC
GACGCGATCGAACTGACTCCATCTCAACATCTTGGGTACCCAGCATCTTTGAGTGGTCTGCCGCTTGTGGTGATTCTGCAACTCGCTGTTCCTTCAGGTA
GTGACTCATCGCTGCGTTGAAGAATGTCTACATACGTTCAGGCGAGGCTTGGTCTTGGTTCCGTTCTGCAACGATCGGTGATCTCACTCCCGAGTTGCGA
GCTTGAAGCATGGCAGCTCCTGACGCTCCGAGTGTCATTCTTTGCAGTTCAATTGAACTACCAGATCCAGTCTCCAGTATGACAGAGCCATACTGTGAGA
ATCCAGTTTGACTGCGGGGAGTCGGTGATCTTGGTAGTTTCGCCGGGGCGGCAACACCAACCAGGACTGCCAACTTCTCGTACAGGGACACTGTCGCTTC
CTCGATCTCGGTTAGTTCCAGATCAAATAGATCGTTCGCGTCAAACGCTCCAGGCACGATCCCTGCTTCCTTTAGCATACGCATCAAAATCTTCACCATG
TCCAGCTTGTTAATCGCTTCTTTGGGTGGAGTCACTGGTCCCTGGAGGTCCCCGAGCAGCTTTGGTCGCATGATTTGCATCACAGGGTCCTCGGATAAGA
ACGCATGGATCTCTTTCCGATAGAAGATCGACCCCAGCTGGTCTTCGGTCCAGACTTTGATTTCGTCACGATCTTCAGCATCCAAATCCGGAGCTTTAAT
CTTCTTTCTCGAAGTCtccgacttcttcttcgaggTCACACGCGAGGTTGGAggagtggtggtggatgaagattcCTCGGTTTTCACTGAAGGACCTTCG
TCCTGCGGATCATGATCAGAATCGCGATCCGTGGGGGCCTGGGGAGGGGTTTAAGGTTTTTCTTCTAGGTCCATTGCTGGCCCTTCCTCTTTTACGTCAT
CAGAGCTCCTCCCAGCGCTCCGACGATCGGTGGATCCTGCTTCATTCAGCAGCGTTGACGGCGATCCTCTTTCCGTCGACGCTTTAATCCCTAGCTCCAA
TTTAACCTTGACATCTTCTTGGTTGGACTCAAGGTGAACTTCCTGGGAGTCACCAGAAAATCCGAACACGCGCACCATTGTGGCGAAGTGGAgatcgtga
aattgctaacacgatccaaactcgtcaacaGTTGCCCGGACTACCGGATAAtggagggggtactccgtAGATCCGTGTCGATGCTGACCTTGAGATCAtc
ttgtgtacccgtcggtggggcgGGTTACGCTCTCTTGGTACTCGGCGGAGATGTCGATTGGTCGTTCTTGGAACCGTATGGACGGTACTTGGGATTGGGG
GTCGATAACCACgcgggaattcttcacgcggttgtCGATCGGCCGATCAGTAGTCTTGAACACTTGAGCTGATCGGGTATGG