Description :
From Genome Similarity Track
Location :
Scaffold_1941:2- 2929
Transcript NameFunction/comments
Phypl_g14431hypothetical protein

Sequence
2927 bases(100 bases per row)
TATGCCGATCTGCGAACTCCGATCGCCTGAACCTGTATGTCGATCTGCAAACCCCGGTCGACCAAACGTGTATGTCGATCTGTCAGAAGGCGTATGTAGA
TCCCGATCGGAGGCCGTTCGCGATCTGCCGTAAGTCGATCGGGATCGCGGACTGATCACGATCGCCCCAGTCCGTCGATCCTGATCAAGAGCCGATCGTG
ATCGCTCGCAGTCCGTAGATCTCGATATCGAGGGCCGGTCGTGATCGTTCGTGATCTGTCGGCGGTTGGCAGGGCTCGGTCTTCACTCTCATCGGTGAGT
CTGCCTCTGCTCGCGAGCACCGGGCCCCCGCTCCACTTGCGTAGGCTTGTATGCCCCCTGATGTCACCAGATTATAACAGATCGCCGTCAGATCGCCCAT
CCTTCATACCGTTCCTTTGATATCCCATGTTCCATATTCTTGATCGGCCTCGATCTGATTAGCCAGGTACCGTCTTTCCTTCCAGCCTCCGACTTGGGTT
GAACGTCCTCCGATCGCGAGACAGGTGCCGCCTCTCTCACCGATCGGGCCCTTTCTCGCACGATCGGAGATTCTTATCTGGTGCTTCTCCACAACCGCCC
CCTATCGGAAGTCGTTGCCGTACAGCGGTCACACTTCGGCCACATTCCCCGATTTACCGCCCCGGACACACTTCTCACTTCTTCCCCATGAGCGACCGCT
CTTCCGAGGCCTAGCGCGTCAGCCGATCGCCTCCGGACTCCCCGCGCAGCGGTCGATCTTGTCGCTCCGACGGTGGTTGGACCGGCCCGAACGAGGCGCA
GCGGATCGCTTTCCTGGAAGGGGAGCTTCGTCGCGTCCAAGATCTTCATGGCAACCTCCTCCAAGCTCGGCTACACCAAGATCGCACGCTGGATCGGATG
GCTGATGACATGCGTAACATGGAACACTTCCGTCTCGACCAAGACGCCGAGATCAGTCGTCTACGCGCTGAGATCGGCCAAGCTCCACAGATTGGGGACC
CGCAactgcaggagcagctccgcctgcaGGCTTCCGAGATCGAGGACACGAATTACCGGCTGTCGATCGCCCAACGGGAGTTCTCCCTAGTCGACGATCA
TCGCCGTGAGCTGGAGCATCGCCATGAGCTAGCCTGCGAGGAAGTCGAGGACCTCCGAGGCCAAGTGAATGCCTACGAACAGGAGTTGGACCGTGCTCGC
GACGATATCATATCCTACTGGGGCAGCTTCGAGTCAGTTCGGGGCGCCCTGAGCAGATCGGAAACTGAAGTCGTTCGATCGAGGGCCGACCTTGATCAGT
TTGCCCAGATCCGCTCTGAACGAGATTCGGCGGCAGCTGACGCGGCGCGATTGGAATCtaagctgcagcgcgtcaccACGGAACTTCAACGTGCGAGGCC
AACAACACCGTCACCCGATCAGGCTTCGTCGGAGCTGATTGGCGCTCGATCGGCCATCGGTCATCTCACTCGTGATCGGGATTCTCTCCGGGCAGAACTT
GAGACCGCCCGACGGGATCGGTCCTCTTCTCAAGTCGATCTCACCGCCACCCGTACGTTCTCGTTCTGTCCTCTGATGTCTCAACGCGATCGGCTAATCT
TTGTTTCCAGTGTAGGTGACGAGTTATCCGTAGCCCGGCAGACCAACCACGCGCTTGAGAACCAGATCGCAGATCTCCAAACGGCCTATCGCCAACTTCG
CCGGACTCAAGACGACATCAGGGCCTGCGTGGAACGTGTCACAGAGCAACTAGCCGACATGGCGTTGCTAGTCGACCGCCATGTGCCCGATCGCGCTCGA
TCGGGAAAACGCGGTCGGGATCGatcggcgtctccgtcgtcaccaccgacTAAAAAAGCGCTTCCTTCGCCGTTgactcctcctccttccgaCCCCTCGC
CTGATACCTCTCCCAAAGCTGTTCCCGACGACCTATATTCTGGATCAGATCGGGGCGAGCCTGAACGTcacgacgagatcgacgacgacggtggtggtgg
agaagcggaCGAAGAGAGCTCCGAGGTCTCTCACGCGTCGGGATAGGGGAGTTCGTCCCCTCCCGAGACTTCCGAGTCAATCCATTCCTTCGAAGAGGAT
ACGGACGACGCgggcttggcggcgctgtctCGATTTCGATcagaagctcgtcgacgcaCATCTCCGCCGGGTGGGAACGCTGCTCAACCGATCGACGTGT
CTGATCACGGCAGTCCGCGCGGTTCACCGGCCGGATCGGGTGGATCTCCCTACGGTGGCTTTCCCCACAGATCACCGCCCATTGATCACCCTGGCGGCTC
GTCGCCTGGTGGATCATCCCCGTCCGGTGGATCTGGTGGTGGCGGatctccaccgcctcctcctccgggGCCACTACTACCGTTGATTCCACCGCTGTTC
CCGATCGCGACCATGATCCCGGGTTACGATCAGCCCCGCGTTCTGACCTAGACCGAGACCGAGCCGTGGCCGGAAATGGCGTTAAGCCAACTGCAGGTGA
CGGCCTTGATCCATGCCAGATTGACATGTCAGGTCCCGATCCCTTCCGGCTGGCACTTCCCTCCGCGTCGCCGAGGAATTCCCGCACCTGTTCCCGGTAC
CGACTACCTGGATCGCCTCACCACGGGTCCCAATATCACTGCCCTACTCGCCACGTTCCCTTGGGTGGTGCTCGAGAATCCAGAAGAGACGTTGACCTTC
GATCTCCCTCCACATCGTCGCGCACAGACAGCCCTCGGGCAGATCGCGGATGCATACCTTGATCTCGAGAGGCGTCATCATCAGGCTTATTGGGAATCCA
CCCACTACTTGCCGATCACAGCAGACTAGCGGGCTGCCGATGCCGTCGTGGATACGTATCATCAGGCGCGTCGCCACCGCAGGATCCGCGTAGGAGAGCA
GTGGCGTGCATTGCTGCGCCAGTTCCG