Description :
From Genome Similarity Track
Location :
Scaffold_2528:2- 2916
Sequence
2914 bases(100 bases per row)
GATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGTTTTTCCCGGAACTGAGGTGCCACCTTCCGCACCCTACATCGATGTCACATTTGACTC
CGGTGGCAGCGGGCGGTAACGCATTTCCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTAACGCAGACGATCCACTTCAGCAGGTTCATTCGC
CCCCGGATCCACTTGGATATCATCAATCGTGACTTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGA
AATCTCCGCTCTCACGCTAAACAGAACTTGCTCGTCCTTCGCTCTTCGCTAGGAATCCACCACATTGGAATACTCAAACAACGCGCGCCCTCTCTCCCCT
GGCAGTCCTTCTATTCTCGGGGGTTCAGGTACCCTGGTATCAGGGAAACCACCAGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCCCGACAGTTCGG
GTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAAGGGAAAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGTTCGGCTTT
AACCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCATCCCCCGTCGTGGATCCAACCTCCATTGCTTGGATCTCA
ACCCGTCGATCCCTCTGCAGGATCGTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGAG
ATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCGTTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTT
CGCCAACCGTCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCCTGGATT
ACGGTCGGCACCCATTTCTCGCCCCGAGTGACCCACCGTTTCTCATGTTCCACCCACCTTAACCGATCTGGCAGTTCCCAAGTTTCCTCGGGCTCGATCC
AGGTTGTCTTATCCGCCCTTATGATCCTCATCTTCGCCCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTGAGGGAAACAAAGTGTCCC
ATCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCACGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAATAC
ACCAAACAACCTGCCAGCGTGATCTTGATCCGCGCTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATCCA
CTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCC
AGCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCAC
AGGATCCAGTGACCAGACAGACCTTAAGTGGATCTGCAGTGACCTCACGCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAAACACG
TGCCTCTCCCATTTGTATATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAACTGACACTTCATGT
AGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTC
GTACCGGATTTAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATC
TGGTTGTAGAATTCTTCCATCGGCCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGC
CACACTTCTCACAGACCAGATGTTTCCAGCATCCTGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGCCCCGTCCATGAGATC
TCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATTCCCCGGTCGGGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACC
CGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCATTTCCTGAGTCGGGCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCG
TCGGAGCCTTTTGGCGATACTTGCTGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCGTCTGC
GTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGACCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCA
TCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGGAGTATTGTC
GTGCCACCGACACTCCCAATTTACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTT
CCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGAATTGACTTTGCTTATCCATGTT
CTCGCTCGGTCCTC