Description :
From Genome Similarity Track
Location :
Scaffold_1964:2- 2889
Sequence
2887 bases(100 bases per row)
CCCAAGAAGGGTTGCATCGTCCGTAGCGACTGTGGTGAAGGACAAGTCTGCCAACAAGGACAGGTCTTTAGGATTCGCCTCCAATCCTTCCTTGGAGACT
CGATGACCTAAATAATCCATCTTGCGCATCCCCCAATAACGCTTCACCACGCTGATAGAGATATTCCACTTAGTACACGCCTCCAATAGGGATGTCACTT
TCTCGCACAGCTGATCCCACGATTCTGCCAGGATTAGAATGTCGTCGATATACGATCTGCGTCCCAACACAGACGGGGTCCCCGGACCTCCTGGCTCTCC
TGCTTCGAATGGATCCACTTCCGTATGATCTTCCCCGGATCCACCCTTTTCGGGTCGAGTGAACCCATAGAGGGCGTTATCGATCAGGCGTTAGTAGATC
TGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCATTCGAACAGTCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTCA
CCACCCAGAAACCACTGGCCATGTCAAGAGAACAGTACCAGAGTACTTTGTCCAAATCTTCCAATAGCTCATTGATTAGAGGCATCGGATATACCATCAA
TCGAGTCAGGCCGTTAACTAGCCGGTAATCAATGCACAGACGTATATCCACTCCGTTCATCTTGATGATGATTACCACCGGAGATGCCCACGGGGACGTT
GAGAAACTGATGCTCTTGGCTTGCAGCAGGCTCTTAATCAGATCCGATAGTTTTTTTCTCGGAACTGAGGTGCCACCTTTCGCACCCTTTGAGCGATCGG
TTTCGCGTCGCCGACATCGACGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTTTCCCAGATCTTC
TGCCGTAACCGATCCACTTCTGCGGGCTCGTTCGCCCCTGGATCCACTTGGATATCGTCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGAGATCA
CCGCCATGCCTTCTCCAAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCCGACTTGTTCATCTTCAGTCTTTGTCGGATCCACCCTTGGATCCAA
GCACCGCGACTCTCCTTCCACCGTCATCCCTTCTGTTTTCGTGGGGTCGGGTATCCTGGTACTGGGGAAGACACCTTTTGATCCTCTGGTGGGTTTACCC
ACGAAGGTTCCTGTTTAGCTAGTGTGGCCACTCTCGACAAGGATCCAGGCAATTTATCCATTGGAAAGCTTGGATCCACTTGTGGGTCAGCGGGATCTGG
CGGTCCGGCTTCAGCCCTCTGCGATCCTTCATCCACCGACCCTGCGTTATCTAGGGGCCGACTCTGGGGATCATCCCCCGTCGTGGATCCAACCTCCACT
GTTTGGATCTCAATCCGACGATCTCTCTGCAGGATCTTTCGCGGTGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCCCCGCCGGGAGCTCCA
CTTCTCCGAGAGATTTCGATCTCGGTAGTCGCCTCGTACGCCAGATTCTGCCATTCTTTGTAGCGGCGGGGATCTCACTGACACATATCCAGGTCGCCTA
GGGATACCGTCCTTCTCCAACCATCGCCCGATCACCTCATAATGGTACAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGAC
CTGGTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAACCGATCTGGCAGCTCCCAAGTTTC
CCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGG
AAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCTGGCACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCGACCCAAA
TGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATTCGCGTTCTCCCGTTCGTACGGTATACGCCTTCACCAATCCCAACACAATCTTAGAT
CCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGTATTGCTTTTTCATTG
TTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCGGATAGCAGATCCATGGATCCAA
CATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTT
CTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACATCGGATCTGGCAAATTCATCCACTTGGCGCAAACTAGAAACCTTGGCA
ACGGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGTGATGTCTTGTTCACAAATGCATAAATGCAATACC
TAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAATCTCTTCTTGGCCACTTCTGGCAACATCCCTATGTGCTTGGCTGGATCA
AACCATTGGCGGATCTGGTTGTAGAATTCCTCCATCGGGCACTTGTGGACGTCGTGAATCTCGCCACAACCACGACACACGTAGAAGCAATGATCTCCGG
GATGATCTTTCTTGCCACACTTCTCCCAGACCAGATGTTTTTTAACGTCCAGGCTCTGTGTGCTTCCGGGGTCCGCACTGCGAGCAC