Description :
From Genome Similarity Track
Location :
scaffold_1627:2- 2883
Transcript NameFunction/comments
g11586.t1 hypothetical protein PHYSODRAFT_262200

Sequence
2881 bases(100 bases per row)
ACGTTGAGTCTTCCGGGTTTGTACTCGACCCAAAGTTGTACTCCGCGAAGAAGGACGACCATCTCGCCATACGTTGCGAGATGTGCGGCGACTTAATAGT
CGTCCGCAGTAATGCGTGGTCTGTACAGACCACGAACGGTCTACTCCCAAGTAGATACACTCGGAACTTTGCGAGTGCATACTTCATGGCAAGGAGCTCC
TTGTCATGTACGGGATAGTTACGCTCAGCTGGCTTCAGCTGACGCGATTGATAGTAGACCACACGATCACGCCCCTTGTGATCGTGTTGCATCAATGCGC
ATCCGATTGCAAAGGCGGATGCGTCACACACTACGTGGAATGGACGATCTTGGTCAGCCACTGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGC
ATCGAATGCCCCTTGGCACTCGGTGGTCCAAATCCACTCAGTTTCTTTCTTAAGAAGCTGTAACAGCGGGCGAATCTTGCCCGCGTAGTTCTCCACGTAC
TTGCACAAGTACGTGGCGAGCCCAAGGAACTGCCTCAGTTCCTTCACATAGGATGGCGTGGGCCATTCATTGATCACTCTGACCTTCTCTGGGTCAGGGC
GCACGCCGTCCTTCCGGACGAGACACCCCAGCACGGGTATCTCGCTCGCCCCGAAGATACGCTTCTTCAGGTTCGCGTAGAGCTTATGTTTCATCATAAG
CTCTAGCAGCTTCCGGAGATGCACCCTGTGCATCTCAACGTCCGTCTTACCATTCACAGCCCGGCTGTGGACGAACACGTCGTCGAAGTAGCTCGGTACG
AAGTCGCGCACCGAGCGCAATAGATGTGTCACGCATCTATTGAACGTCGCAGGGGTATTCTTAAGTCCCTGTGGCATGACGAGCCACTCCCAAAGCCTAC
CGCTTGGAGTGCTTACCGCTGTGAGAGGTATATCCCTCTCACGCATGAGGATTTGATAGAATCCATCACGCAGATCTAGAGCACTGAAGATGGTGCTCAA
GGCCATCGAATCGATGATCAAATCTTTTCGCGGTATCGGCGTCTGCGCCGGTATCGTCGCATCGTTCAACTTGTTGTACGCATGAACGATGCGCCAGCCG
CTCTGTGGCTACTTGACACAGAACGTCGGGGCACTGTGTGGGGACTTTGATTCCCGCACTTGACCTGCAAGACGACGACTTTCAAAGAAATCGTCGATCG
CTTGCACCTGTTCGCGCGGTAGTGGCCACTGCCGCGTGGCACAGTACTTCGTGCCCGGTACGAGATCAATCTCGTGCTGTACGCCCTTATCCTTCGGAAG
CTCCGAAGGAATCTCGTCAGAAAGTACATCCTTGTACTCCCGCAGAATGTCGTAGTAGGGACTCTACCTCAACGAGTCCCAACGCTGCCCCTCGAAGCGC
TGCTTCTTGGTCTTCGCACTGAGGGGACATCGCCCTCAGCGATCCCATCGCCGACGAGCTGCTTCAGCTCTTCGGCCTCGCGTTTCACCCTCTCAACGTC
TGAGAGGATGCAAATTTGTTCGATGCGTCCATCGTACAAGTCCCGCGCGAAGCGCTTCCAACTCATAGTTGGAAGTGCGGTGAACGCCGACGCACACGTC
GGCGGATTCTCTAACCGCATCTTCTGGTACTGCAATCCAGTACCAGTACGTGTCAAGACGTTCAACGTCTCGACACTCGGTGTCTGTCCGGCAGATACAC
CCGTCTCAGTCCCGGACTGAGACTCACGCAGCTTCTGTGGCTTGCGCCGTGAAGTTCTTCCCTGGAGCCCGGCTCCAGGTGCTCCGCGTCCAAGGGCCTT
CGCCTTGGACGGGTCGTTATCACAATAGTCGTCAGCGGATGTCTTCCGCTGACTCGCACAATCAAGCCCGGCTTGTGTACCGCTCATCGCTTGCAGCACT
GCTGCACGTGAGCACGCAGGTTGTTCTGGTGCTGGACGTTTGCAACCGCCAGCACCTCCTGCCGCGTCGTTAGTTTCCCGGAACTAACGCGCCTCCATCA
ACTCCCGGAGCTGATAGATCAAATGCATCACCAGCTCCCGGAGCTGATGTGCCTTCACTAGTTCCTTGAACTAGTGGCCCTTTGATTGTGACGTCGACTC
CCTGAGTCGACGCACCCGCGCCTGTGGCGTCAGCTCCCGGAGCTGGCGCACGTCTATCGGTTCCCTGAACCGGAATTCTATTGGCTTCGTCAGCGCGACC
CTTGGAGGCTTGAAGTACCTCCAACGATACCGGTACTGATACCGGTATCAGACCATCATTCAAGTGACCTTCACTCAGATGAATCAGATGATCATCATTC
AGATGACCTTCACTCACGTGACCCTTGTTCACGTGATCACTCAGGTGACCCTTCGGCTCAGACTCAGATTTCTGAGTCGAAACACATTTTCTCTCAACGA
CTCCCGGAGTCGTCAAGGGTCGCCGGCGGCGATCGGAGGCAGCGGCGGCTGCTGCTGTCTCAGCTGGGGAGTCGCATGCACCGGCAGGTGCATGCGCGGT
ACTGACAGGGCCATCGCTCTCTGTCGCGCCCATGCTGTTGAAGCGTACAAGCGTACGCTTCTCCCAGTTGATCACCGGGTCATGCTGTGCAAGCCACGTC
ACGCCTAATACCAAGTCGAACTTATCGTCTAGATCCAAGACGATAAGATCTTCCACAAACGTCCTTCGTTTGTATGAGAAGCGCACACGGACTACGCGCT
TCTCAGTTCTTACGGTGGCACCTGTACCTCAAACACACCGCGAGGTGTGTCGGTCTCTTCGAAGTCAAGCCTTCGAAGGCTCTTCTGTCGAACAAAGTTG
TTCGACGCGCCCGAGTCCACTAGGGCACGAAGAGAGTTAACTCTCTTCGACATAACATCCAGGATGACAAGACTTGGCTTG