Description :
From Genome Similarity Track
Location :
Scaffold_2517:2- 2840
Sequence
2838 bases(100 bases per row)
GGAACCCCCAAGGCTTCCCGGTGTTATCACTTTGGGTGGACGGAGTAATGCCGGATCCGTGGTGACATCAAACACCCCACCGACCCCAACCTCCCAACCG
GATCGAAGGCGGTACGGCCACGAAGATCGATGCTCCGTGCTCCGGCACATAAGTACTGTGTCCACGAGGCAATGGCCTCTCCCGCGGCGAACAGTGCGAG
GTCATTGATGCCTTCTTCGCCGCGAAAAGCGAAGGCAGGCATTGGTGCGGGAGTCGAAATTCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAA
CCGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGATCAACGCAGCGGTGCCGGCCCAAACACCGATTCCCACGAAAGGATGTGTTGTTGAACAACA
TGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCC
AAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGT
ACCTTCGTACAGACGTACTTCGACGACATTTTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGT
TGGACGTGATGCGAGCGAACAAGCTCTACACCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGG
CGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGTTTGGCCAACTACCTT
CACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCTTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTT
TTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCAT
CGGGTGTGCATTGCTGCAGGACGACACGGCTGGACAGGAACGAGTCATCTCATTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCAT
GACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCAACACAGACCACGCGTCCTTGA
GGACGGCGACTAACTCGCCTCACCTCTCCCAACGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATATAACTTCCGCGTCGAGTACAAGCCGGGCAAGCT
CAACGTGCTTGCGGACGCCCTCTCTAGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTAT
CGGGACGATGAGGCTGTCGCGCCTATCGTCAAGCTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGACTCCACC
GATATAAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCT
CGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCTGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGG
GTCGCCCGATACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTTTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTT
GGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACA
TCTTGCTCCAGTTCCCGTCACTGTAACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCG
GACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGATCATCCGCAGACAGACG
GCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTT
TGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAAACACT
GACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAGGCCCTTTCCTCCCAGGTCTCGGATGTGAGGCCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTA
TGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCGGACAAACAAGGAAGAGGAAACTT
AAGTATATTTGAGATTGGTGACTTAGTGTTACTAGACACGAGGAACCTACCTCTAGACACTGTTAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTC
ATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTA
AGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAG