Description :
From Genome Similarity Track
Location :
Scaffold_2731:2- 2796
Sequence
2794 bases(100 bases per row)
GGAGTACTCGGACAAACAAGGAAGAGGAACTTAAGTATATTTGAGATTGGTGACTTAGTGTTACTAGACACGAGGAACCTACCTCTAGACACTGTTAGCT
CTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGAC
GACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCGAG
GGCCGGTCACATTCGTCGACGAGGTCGTCGGAGCAGACACTCAAGCCTCGGCCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATA
CGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGC
AACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCT
CCACCAGGTCCAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCTTTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAG
CACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTAC
TCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGCCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGCAAG
CATCAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGGAGGCTGTCGCAATCT
GGGAACAGAAGCGGCGGCAGCTTACATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGTACGGTCGATGAATACATACCGTACCCGCGCTCATCGTGAGCG
CTAGAAGCCGCGCGCTTCAGGATGTTCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACA
GCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAATAACTCCACGTGGGACA
GTTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTGCGACAAGTCGTGAAGTCCTTAAGGGGAATGCGG
TGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAAGACTCGTTCATAGATGCCCCTAGAAGTGTGGC
CGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCC
CTGGCTGACGGGTGCCGCCAGGGAACCCCCACGCACACGCTGGGCAGCTTGGAATTCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCA
ACAATGGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTTGAGTCTCCTTCTCCTCGC
GGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTT
GCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCG
TGATCACTAGCGGGCGACTGCACGCTGCCTTCTTTGTGCTCACTGGGCACTGGGCGGTGCCCTCCCACAGAGCCCGCAGGAGCATCCTGAGTGCTCTCGG
GACTCGGCATCGTCTTCACTGCCCGAGTTGAACTCGCGTTCTACGAACCGAGGGTTCCGGACGGTTGTCTGGAGACGAGAGCGACGGACTGCGGCGCCTG
CTTGCGCGCTTGGTTGCAGCCGCGTCACCCGAGGAACCGATCGCCTCGGATGCCACCTGAGTAGCCTCCTTGAGTGCAGAGCCTTTACCGTGAGGCTTAG
TGCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCGCGAGGCATGTTAACGGTCGAAGTGGAGACCTT
GACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAG
AGTTTGTGACGAACACCTCTTCATTTTGATTGGTCGGTCAACCGAACCTAAGTGGGGGAGGAAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACATG
AAGTGTGACACTTCACACTTCAGGAGTATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCGTTGAAAGCCAACCATTGGATAAATGAC
ATTGCATTTCTATAGGTAACTAACAGTTTGTATTTAACCCAAACTTAATCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTGGGTCA