Description :
From Genome Similarity Track
Location :
Scaffold_210:2- 2781
Sequence
2779 bases(100 bases per row)
ACTGGACGTCGAGCTGCTGAAGGTCTCTCCTGGCTACTGTGGTGTAGTAGAACACACAAATATCGTCAGATGTGGATTCCTTACACAAACCACAACGAAT
CGCCGAGTTAGGTCGGCGGTTTGTATGGCCTGCGCAGAGGGTGGTCCCCTCGCGGTCCGGCCCTTCCGGGACAGACGAGTGGTTCGCTTCCACCCGGTTC
CGACTAACCAAGTCAGATCACTTCCGAGGCTCCGCCGAGTTTGGTTCGGCTGAGCTCGTTCACAACCCTGTGCCCTCCACCAAAGGATGGACGACGGCGC
GCGAGCGCTTTTACAGGTCACCGAGCGCAGAGGCAGCTCAGCTAGAAGTGTTACGGCACCCGGGCTATCCGACGTACCGGCCCGCTGAGTATGCGGGACT
TTCTTTCGCGCGTAGCGAGACTTTGTCCTACCCGGACCGACCTAATCTCTTGGCGCTACCAGTCAATACCCTACAAGCTATGCCTCTCGAGTATTGACGG
CAGGCATAATCCAGCTCTATGCAGGGACTTACCGGAAAAGTGTACACGTGTCTTGACTAGAAAAATTCTGCTCTGTTATCTTCTGGGAGCCCTTTCGGCT
CCCCCTATTTAATCCTATGCTTCTCATACAAATATCTAGTGAAATGTAGTCGTTTCGGATCGCTACCGACCCCTTCAGCTGAGTTCGGGCGACCGTTGAG
CTCAGCGGTTTATCCGGATAGCATATCCGGACAGATCGCCCGAGTACTTTACCGTGATCCTTTGTTCTTAAGTTCTGGGTTATCAGACCGAGCCCGATTC
CTGACCTAAAGTAGGTCGGCGTATGGTCGAATCTGGAAATCTCTACACCACAACTGCCCCGATTATGATACGAGCCGAGCTGGTGAGTGTCTTAATCCTT
CATTTGGTCCTGCCACCGTTGGTCCATACTCGGCTGATGATGTCCCGCGGCTCTCCACCACCTTCTTCGGTACGTTTGTTGCTTCCGCTGTCACTCCCTT
GGCAGCTCCTTACTCCTCGCTTGTTACTCCAGCACAACTCGCGGCACCATCATTCTTCTCCAACTCCTCGTCGAGGTGAAGGCGTGCCAGCTGAGTCGAT
TCCCCGACCCGTCGGTACTCGTGGGGTCAGCGACCGGCCTGAGGCTAAGCTGGTCGACCTGACAACTTCTCATGCGTCTGACGCGGAGTCGGCGGGGTCT
TCTCGCGTACGCCTTCCTGGTCCACCGAGCTTGCCGGGCGACACCACTTCGGGCGCTCTACACATGTCAGCCAAGCTCGGCTGCTCCAAGTGAGTCTTTG
ACTCCCTCATGGCCAGAGTTAACGAACAAGGGTATGAGCGCCGAGAAGAATTGACCTTCTTGACGAGGCTCATGGCTTACGGATTTACTCGTTCCGTGGA
GCCCTTCGATCCCGTGCAGCGGCGAGCGATCTTGCATGCTGCTTCCGCGGGAGAACTGTTGGATATCTTGAAAGGCAACTACGCCGCTCTTAATTATCCA
CAGATCATTGGCGATCTCCGAGCTGACAATTAAGCTGTTCAGGAGGAGAACCGCTCACTGACTCGGCGACTGGACTCGCTTGCTCTCAGCAACGTCGACT
TGTCAACTCAGCTCTCGTCGGCTCAACAGCAAGTGTCTCGATTGGAGGCTGCTGCCACGCAGTCGGCTAATTCCCTCGCGTCACTGCGAAAGGCTGTAGC
TCTGAGTGAGGCAAAACTTGCTCGGGCCATCGCAGCTGAGCAGAGCAAGGTTGACGCTGCGTTGGGTCAGGCCCAGCTCCATCATCAGCAAGTCTTGGAT
CGAGACGCCGAGATCGACGTCCTTCTCCGATCCATTTCTGAGAGGGATGCGGCGTTCGTCACCCTTCAGGGCATTGCTTCCAAGCACTTCGAACAGCTGC
AGGAGTCGGTGCGGTTGTACAGCTCCACCGGCACTCAACCTTTGCGGCACGCTCAGTCGGTGATCGCTGAGCAGCGGGCGGTGATCTTGCGACAGAAGCG
GCTCATCCGTCGGAATGGCATTATTCCGATGCACGACCCTCACATGGCTGCTGCTGCTGCTGGCGGTGGCTTGCAGGTTCCTGGACTTGATCCGTCCGAC
CTTCTCCTTAACGCTCGGCTATGTCGTGTCTTGGAGTCTCGCTTCCCTGAGGTTCTTCACATTCCATCCGGTGAAACTCGGCGGTTGGAGTTGATTGTCC
ATCCTCGCCGAGATGCTCCAGTGGCGAGTTCCGCTATTGGTCCTAGTGTGGCCCTCCCAGCTAGTCAAGCGTCTTCTGTGACTTCATTGGCAGACTCAGC
TGCGACTCCGGGCAGGTCGGCGGCGGGTACGAGCCCAACCCCGAGGCCGACCCGTCGGCCAGTTTCGCCGGAAGCTTGTGGGGAAAGTGAGAGTCGACTC
GCGGGTTCGAAGGGATGGCAGACCAGAGAGTACCAAGGCGGCAGGATGGCGGGATTCATGCGCAGGGGCGCGATGCGGAGTAAGCGGTGAGAGTTGTTCC
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN