Description :
From Genome Similarity Track
Location :
Scaffold_2361:2- 2748
Transcript NameFunction/comments
Phypl_g14998hypothetical protein

Sequence
2746 bases(100 bases per row)
GGCGCGGCCATCTTGAAAGATCCTGCGGATCCGTACtatccgctgctgctggagtacGCGGATGTGGTCTCGGAGGACCCACCGTCAGTGTTGCCTCCGG
ATCGCGGTGTCCGACACGAGATCGACCTGGAACCGGGTACCAAGTACTGTATCACACGTCAATGGCCGCTGCCGAAAGACCAGGTTGATGTGATCGACGC
CTTCTTTGCGGCGAAGCATGCCGCAGGCATGGTGCGCGAGTCTAAGTCGCCGCATTCAGCCCCGACGTTCTGCGTGCGCAAACCCAACGGGAAATGGCGC
ATGGTCCATGCCTACAACAAGCTGAATGCAGCCACGACCCCGGCGTCAACGCCAATCCCTCGGAAGGACGTGTTGCAAAACAACATGGCGTGGTGCACGG
TCTACAGTGCGCTCGACATGGTCGATGGGTACTATCAACTGTTGATGCGCGAATCCGACATTCCGCTCACAGCGGTGAGTACCCCCAGCGGTATGTTGTG
GGAATGGCTAGTTATGCCCCAAGGGCTCTCTAATGCGCCAGCAACATTCAACCGACTGGTGACCCAGCTCTTCCGGCCGATGCGGAAGTTTGTACAGACG
TACTTTGATGACATCTTCGGGCACAGCTGTGCTGCGGAAGGTAAAACGGCTGATGAAGTGCATATTGCACACCTCAGGGAGGTCTTGCAATGCATGCGGG
AAAATCGGCTGTTCGCCAACATCAACAAGTGCATCTTCGGTGCGGAAGAAATACCGTTCCTCGACTGCTTCCTGGGGAAGGATAGCGTTCGGGCGGACCC
CGAAAAGGTCCAAGCTATATCGCAATGGCCGGTGCCGACATCCCACCGGGACTTGCGCAAGTGGCTTGGCTTCGCCAACTACTTGCACAAATATAGCGAG
AACTACGCCGAGTTGGCCAGGCCACTTACCAACCTTCTAAAAAAGGAGGCGGCGTGGTCCTGGACCGAGGAAGCTCAGTGGGCCTTTGAGGCTATCAAGC
AGAGCTTACAGAGCGCGCCAATCCTGGCGCTACCAGACGGGGATCGTTCGTTTAGTGTCGTGTGCGACGCCTCGGACTTTTCCATCGGCTGCGCCCTCCG
TCAGGTCGATGCCGACGGCAGGGAGCGCGTGGTCTCATTCCAATCGAGGCAGCTCAAAGCCGCGGAGAAGAACTACCCTGTTCATGACAAGGAACTCCTG
GCGATGAAATACGCGCTAGTGAAGTTCAGGGTGCACCTGCTGGGCAGTAAGCCCTTCGTCATCTACACGGACCACGCATCACTGCGGACGGCGACCTCGT
CGCCCCATCTCTCGCAGCGCATGGCGCGTTGGCTTTCTTTCTTCGCTGAATACAACTTCACGGTGGTGCACAAGCCGGGAAAGCAGAACATCCTAGCGAA
CGCACTCTCCTGGAGACCCGACTACGAGTTGGCACATGCTGTATGTCTCGAACCATCGCTCTCTGAGCTAATTCGCAAAGCGTATGCCGAGGATGAGGAG
CTGCGAGATCTGGTAGAAGCGCTGCGCGCTGATTCCGACGAAATCAAGCTGACAGCTCGTCAACGCGCGCGGTTGCACCGCTACACCCTCGCGAATGACC
TCCTCTACTACCACGTAGATAAAGAGGACGAACCTCGGGTGGTCGTccccagcgacgaggacctgAGGCACCGAATCTTCTATGAGGCGCACGACACGCC
GCTCAGCGGTCACCTCGGAAGGGAAAAGACATACACGTCGGTGGCCAGGGACTATTAGTGGCCCCACATGTACAAATGGGTACGCTCTTACGTCAAGACT
TGCAAGACCTGTCAGCGAGTGAAACcggcgccttcgtcggcgGCCCCGCTAATGAGTCTGCCGGTACCGACTGATTGCTGGCGCTCAGTGAGCAtggact
tcatcttcgaccCACCGCCCGATGGGCGAGGCCATACTGGCATCTTAGTCTTCGCATGTCGCCTGAGCAAGATGGTGCGGCTGGCGGCCGTGAAACGGAG
TGTTACGGCGCCAGAGGCGGCCCAGCACTTCACAGATAATGTCTTCCGTCATCACGGCCTCCCGGAGGCATTCGTCAGTGACCGAGACCCCCGCTTCGAC
TCTCATTTCTGAAGGCACCTCTTCCGGCTGCTCGGTACGCAGCTGGACATGTCCACGGCGGACCATCCTCAGACCGATGGTCAAACCGAGCGAGTCAATC
GCGTGTTAGAAGATGTTCTTCGCAGTGTCTGCGTGGCAGAGCCCACGGAGTGGAGCACGCAGTTGGCGCAAGTCGAATTCGCGTTGAACAACGCTGTTCA
CGCTTCCACCGGCTTCACACCCTTCTACGTGAACGGGTTGCGGCATCCGCGGATGCCACTATCGTTGCCTCCGGCTTCTGAGTTGAGTGGGGGAGAAGCT
AGCGCTAATGACCCAAGGGGCCTCACGGGTGTGCCCTTGTCCGTCAAACGAAACTTGCTCTCGCTCATAGAGTCTGGAGAAGCCAtccgcgtccgcgtcc
gtgacgccatggcagcagcacaagaccTGCAAAAGGAAAACAGCGATCGCCATGGGCGTAAGAACACTCAGGTGTTTAAGTTGGAAGACTTTGTATTACT
TAATGCTAAGAACCTCCCTATCCACGCAGTGTCTGCGGTAGGGAGCACCAAGCTCAGGCCACGCTTCGTGGGCCCGTTCACGGTCATCGGAGTGCATGGC
AACGCCTACACTCTGGACTTGCCATCACGCATCCCATGTTTTACGT