Description :
From Genome Similarity Track
Location :
Scaffold_1308:2- 2734
Sequence
2732 bases(100 bases per row)
CGGCCAAGAACCGCACAAGAGGTCCGAGACTGGCATCGTCTCGGTACCCCAGCCTGATGCGATCATACAGATCCGTCGTGACCCGACTAATATGAGCAAG
CTCGTAGTCGGGTCGGCGCGACAGCGCGTCGGCAAGCACGTTCAACTTGCCCGGCTTGTACTCCCCACGGAAGTTGTATTCCGCGAAGAATGACAGCCAA
CGCGCCATCCGCTGTGAGAGATGTGGCGTGTTGACGGCGGCAGTCCGCAAGGACGCGTGGTCTGTATAAACGACGAAGGGCGTCGAGCCCAGGAGGTGCA
CTCGGAACTTGACAAGAGCGTACTTCATGGCAAGTAGCTCCTTGTCGTGGACTGAATAGTTCCGTTCGGCTGCCTTGAGCTGCCTGGACTGGAACGAGAT
GACCCGTTCGCGGCCTTCATCGTCGGCCTGCAATAGCGCACAGCCAATTGCGTAGTCAGACGCATCACAGACTACGCTGAAAGGCTTCGTCTCGTCCGGC
AATGCCAGGACTGGCGCGCGCTGTAAGCTCGCTTTGATGTCGTTAAAACCATCTTGATGGCGACGCTCCCAGCGCCAGTCGACATCCTTCTTCAGGAGAT
CCGACAAGGGCCGTGCCAGCTCGGCGTAGCCTGCACTATACTTGTGCAGGTAGTTGGCGAGGCCCAACCACTGTCGTAGGTCCTTCTGCGACCGAGGTGG
CGGCTAAGCCGCGATGGTTTTCACCTTCTCCGGGTCCGCCCGGACCCCGGCGCTGCTGACGAAGCAGCCCAGGACCTTGATCTCCTCAGCTGCGAACACA
CATTTGTCGATGTTGGCGTACAGCTTGTTCGCCCGCATGACTTCGAACACACGTCGAAGGTGCTGGAGATGCACCTCCATGGCCGTCTGGCCTGCCTCGG
CACGGCTGTGGACGAAGATGTCGTCAAAGTAAGTCTGTGTGAACGCACGCAAAGGTCGGAAGAGTTGTGTGACCAAGCGATTGAACGTTGCCGGGGCGTT
AGAAAGCCCCTGAGGCATGACCAGCCACTCCCAGAGCATACCGCTCGGCGTGCTAACAGCCGTGAGTGGGATGTCGCTCTCGCGCATCAGGCTCTGGTAG
TATCCGTCCACCAGGTCCAGCACGCTATACAGCGTTCAGCCGGCCATGCAACACGGGCGGGATCGGTGTCTGCGCAGGCATTGTCGCGCTGTTCAGCTTG
TTATAAGCATGAACCAGACGCCACTTTCCGTTCGGTTTGCGAACACAAAAGGTAGGCGTCGAGTGCGGGGACTTCGACTCCCGCACCATGCATGCCTTCG
CCTTGGCGGCAAAGAAGGCATCAATGACTTCACACTGATCCCGGGGAAGAGGCCATTGCCTCGTGACACAGTACTTCGTGCCCGGCACGAGATCGATCTC
GTGCCTGATTCCCCTGTCCGGAGGGAGATTGGACGGTGGATCCTTGGACACCACGTCCTCAAACTCCTTCACCAAGGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN