Description :
From Genome Similarity Track
Location :
Scaffold_3017:2- 2687
Sequence
2685 bases(100 bases per row)
CCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTG
GCAATCTCGCAGATTTTGCTGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCT
CAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGA
GGAACTCTGTCGACGGAAGAGAGGTGGATCCGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGA
CGCAAGTCAAGATCCGCTAACAAAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACCCAAGC
CCGCTAGTCGAAGAAACCAAGAAAGAAAGACCGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAAGAAGACCAAGCTGGATCC
AGGTCAAGCTGGTCCGACAAGGATCTCGAGTTTGTGTATCGCCACCAAGCTATACGCGATTTCCTGCATCAAAGATCCTGTCATGCAGATCCTGAATCCA
CGACAGATCGAAGATCCAAGAGAACCGGTGGGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATATATTACGTCTGTTTACGGAGTCAG
GCATCGTAGCTGTGTGATCGACGCAAAGGAAATTTTCGGAACTGAAACTGGAATCTTAAAATATTTCGGCCGCGCCGGAACCTCTTTGCCGGAGTAAAAT
TAACTACCTGGCCCGGAAAAAGGTCGCGTACTATGGATCCAGTGTCGTCACCGAGGATCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGA
TGAGTCAGATACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGACCCGAGGACAGGAAGCCCCT
GTGAACGCGAAGGCTCAGGACCCAGTACGCCCTACGCGTGATCTGACACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGGTTGTCTT
CAGATCGGACTCAAGGTAATCGCCTCACGGATCCTGTCTCGCCAGTGGACCAGCCGGCCACGGGCTCTTCCGACACCTCCTCGGGCACCCTGCAGCGACA
CTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTATGAGAACGCCCGTGCCACAAGCGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAG
ATGGAGTCAGTGGAGGGAGACAACTCCCATGATGAGCTCGACCCAGATGATCTGGATGGCCCATCCACTTTGTCAGCCGTGGTAGCAACAGCCACAGCCG
GGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGTTCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAAC
ATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAAC
TGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGAC
AATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTGGAATACCTCCATCGACTGAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGG
GGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACATTGGGAGACGTGGATCTGGCCGACAGGCTGACCCTGTTACGACTTCCCGACGCA
GACGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGC
CCACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCTGACTCAGGAACTGAGTCAGGATCCGACGGCTCGGACTCCGACCCTGAAGATTACCGTCG
AGCCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACAGGAGACAACTGTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGA
GATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTG
GCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCACGGGTGTGGCGAGATTCACGTCGTCAGCAAGTGCCCGATGGAAGAATTCTACAACCA
GATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCAGAAGTGGCAGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTAC
GAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTATCAGGACCCTAGATCCAGTCGA