Description :
From Genome Similarity Track
Location :
Scaffold_3014:2- 2663
Sequence
2661 bases(100 bases per row)
TCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGT
TAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCCAGCAATCTCGCCGATTTTGCTGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGG
TGACTCGGAATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTG
AATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGTGGATCCGGATCCGGATCTAGAAGAAAAACCTCTCTATC
CTCTCCAGGTCCCCTCGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACAAAACAAGGAAAAGTGAAGGCGAAACGGTATGCATTTGCAGAT
TCACCGGTTAAGCCAACACTGTACCTTAACCCAACCCCGCTAGTCGAAGAAACGAGAAAGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAG
CTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGGTCTCGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCA
TCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAAAGAACCGGTGAGAGCACCAGCAAAAACGGCGAACAAGCTGGTGGCAGTC
AAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGCGTGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCGCATAGTATCCGCGA
CGCGCGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAATGGTCGCGCACTATGGATCCAGTGTCGTCACCGAGGATCAGCCAAGCTGCGTCCTCGAA
CTACGAATCCGCGGCGGAAGATGGCTCCTACACGTCGTCCGAGCCCCGATGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGGAGCGCGGGCGAGG
ATCCGAGGACAAGAAGTCCCTGTGAGCGTGAAGACTCGGGATCCAGTACACCCCACCCGTGATCTGATACAATCCAGCCAAGATCGAGCCAGATCCGGCA
AGAAGCCAGTGGGGTTATCGTCAGATCGGGCTCAAGGTAATCGCCTCACGGATCCTGTCTCGCCAGTGGCCCAGCCGGCCACAGGCTCTTCCGACACCTC
CTCGGGCACCCTGCAACGACACTTCGAAGCTGCGATATGTCGGTTTCTGGCCGAACAAGGTATGAGAGGGCCCGTGCCACAAGCGCAAGTGCTCCACGAA
CATGGAGCACGAGACGTGGAGATGGAATCAGTGGAGGGAGACAACTCCCATAATGAGTTCGACCCAGATGATCTGGATGGCCCATCCCCTTCGTCAGCGG
TGGTAGCAACAGCCGCAGCCGGGGCGGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGATCTGATGGAGTTCACGGGCAAGGCTCA
AGATGAGGGCCGAGCGCGAACATGGATCAGCAAAGTCAAGTCGGCTATCATGAGAGATCAAGCGTCGACTGCTGAGAAGTGTCTGACCTTTGCGGATCTG
CTAGCGGGGCCAGCCAGGAAATGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGAT
TGGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTAGAATATCTGCATCGACTAAATGTGGCCGGTCTACGGGC
CAATTTGAAGATCAAGGATGGGGGATCCAAGGTACTACGGGAACATTTGGATCATTTCATCGAGACGTTGGGGGACGTGGATCTGGCCGACAGGCTGACC
CTGTTACGTCTTCCAGACGCATATGAGCTTGAAGAAGTGCCGCGGGCTGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCTAGT
ATCGCCAAAAGGCTCCGACGCCTACGGCTCCAGCTCGACGTTCACAGCGCCCGACGCAGGAACTGAATCAGGATCCGACAGCTCGGACTCCGACCCAGAG
GATTACCGTCGAGTCTGTCTCACTGCATCCAACTATCGAACGGCGAAGACCGGAGACAACTCTCGACCGAGGGATACCGTACCCGGGGACCGTGGGATGT
ACAGATCCCGAGATCTCATGGACGGGACAGCCCAGGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTG
TGAGAAGTGTGGCAAGAAAGGTCATCGCGGAGATCATTGCTTCTACGTGTGTCGCGGGTATGGCGAGATTCACGACGTCGGCAAGTGTCCGATGAAAGAA
TTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACAGAGGGATGTTGCCAGAAGTGGCAGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTT
GAATCCGGTACGAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCG