Description :
From Genome Similarity Track
Location :
Scaffold_3234:2- 2609
Sequence
2607 bases(100 bases per row)
GGAGGGACTTCGTGTGAGCGCAGCTCGAACGGAAGTGTTCCGTGTACACGAGAGAAGCGCGAAGCGTGGCGGACCCCCCGGTTGTGGCATTGAATGCCGA
GCACAACTTCAGGTCGGCGCGACCTGGTTGGAGCGCTGGTAGCGCAAGCTCTTCGAGCGGTCCAGAGCCGATGGACCTCAGCTATGCTGAAGATGAAGAA
GCGGAGCTTCTTGCTGCGGAGCAGCGCGCTGGCATCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGGGCCTATTGCCCTCTGCGCAAGAAGC
GCGAGGCTCCGGCGAGCCAACCCTCCGGGTCATCGCCGGGAAACGGCAACTCCCAGTAGGCGCGGGGCGGCCTACTGGGGAAGAACTGAGTTCTGTTGTG
CCTCGAAGAGGTAGAGGGCAACGGGGCTCAGCCCCGAAAAGAGCTGAGCTCTCTTACGAGAAGAGTGTGTGCAAGCCGGGCTTGCTGGTCGTTCAAGCGA
ACGTGAAGGGCTTTGCAAAGCCATGGAGAGTCTTGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCACCCTGGAAGGGAGTCAGCTGTATGC
TGAGGCACTGGAAGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAGGTCTCTGTCGACCTTGGAGTGAAG
TTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTTAGACCTGGATGCGAGGTATGACCTCATCCTTGGCATGGCATGGCTGGAACGTCATGAGCCAT
GGATCGACTGGAAGTCGAAAACGCTGGGTGCGTCGCACCCTGCTCCTAGTGGAGTTTTGGTGAGTCATGAACCCACCTCTGCTAGGAAGCAGAGGCGCTT
TTGGCGCGAGCACGAGGCCGAGGCGGCCGTAGTGCTGGACATTGGTATGTCCGAAATTGTTAGCAACGAGGTTGTTGTTTGCCCTGAGGGCGTACGTGGT
GCGGCACGTTATCCCGCGGAGCGGTGCAGGTCAGTTCAATGACCAACTGCTGGGTCCTGGTGAGGACGAGCGCGGAGTGGCGCGTAATCCACTGAGTGGT
ACGAATCTGGTCGATGACCTACCGCTGCGTGACCCGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTGGCCCAGGAGATGCAGGTGAAGTGA
CACCTAGTTCACCGTGTGAAGGTCGAGGACCTCTTGGCTTTCAGCCGTGTGTCTTGCGAGACACTGTATCCTCTTCGAGGAGTGATGGTGCTGCTGCACC
CGGTGGTGGTGACGGAGATGTCGCCACACCGCCCTCATCCGGCCGGGCTCGGTCGCGGAGGGAGAGGAGAAGAAGACGCAGGGCGTCTGTGACGTCTTCG
ACGTCGGACGAGGTGTCCAACGTGACGAGCGGTGATGCTCCACGTGATTGCTGTGAACAGCTGTATACACTCGTGAACGGAGTGACGGGGGAGGTAGAAG
GCGATATCAGCCTTGACACTCTGCCCGCTGCAGAGGCTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTCGGCGAAGCCTTAAAGGCAGGCGAGCT
AGCCGAGATGGTCTTGCTGGGACCTGAGGAGGAGTTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACACCAAGAAGGCGCTGAGCGCAAGA
AGTGGATCGGCGATCCTTAAAGATCCTTCGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCAAAAGACCCACCGACGGGCCTGCCTC
CGGATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGAGAGAGCAGTGTGACGTCATTGA
CGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGTGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGTGTCAGAAAGCCGAACGGCAAGTGG
CGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGCTCTGCAGAACAACATGGTAGGCTGTA
CGTTGTACAGCGCGCTCGACTTGGTCGATGGCTCCTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCT
CTGGGAGTGGCTGGTGATGCCCCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGTTGTTTAGGCCCCACCGGGCGTACGCTCAA
ACGTACTTTGACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGATGTGGATAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGC
GCACTAATAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGCTTACGGGCAGA
TCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCGTAGGCTTAGCCAATTACTTGCACAAGTACAG
TGCGGAA