Description :
From Genome Similarity Track
Location :
Scaffold_1704:2- 2588
Transcript NameFunction/comments
Phymu_g13569reverse transcriptase

Sequence
2586 bases(100 bases per row)
GTTGCGCGAGGTGGACTTCGCGGAGCTACGATCCAAGGACAAGATCCCGACAGCCGAGAGCCCATCAACACGGATCCAGATTACTGCGGGGACAAGTGGA
CCCGAGCGACGACTGCATTTGACGCtctgaagatcaagatcgcGACAACGCCAGTACTCCAACACTTCGATCCTGAGAAGCAACCAGTAGTGATTGTTTA
TGCGAGTGAATGGGCTGTATCGGCGTCGCTGACGCAGAATCACGATGGAGTTTACCTGCCGGTCATGTTTGTGAGCCGATCCTTGAAGCAGAATGAATTG
AACTACGGGATCGTGGAGAAAGAAGTGTTGGCTCTATTGAGGATGCTGGATCTCGGTTATTCTATGCTAGTTGGCCGGCGGATCAAGATCCTGACTCGGC
ATTCCACCTTGGCATGGCTGTTCCGCTCTTCAGGATTGCAAGGACGCCTAGGACAGTGGGCTGCTCTGTTGTCCCCATGGTCTTTGGAGATCACGAGGTG
TGCAAAGGGCGAAGACGAGATCCTAGGAGCGCTTGCAGCTAGCATTACACCCCGATCGGAAGTGGACCAGGCGTTGATCAACATCGCCCCCAGGAAAGAA
CCCCGACGAGCGATCCAGATGCCGGTACCGACTGTGCgactggacgagcagctactggtGGTCAGTTTCGATGGATCTGCCCGAGTCAAACGGGGCGGAG
GCGCGTATAGTGCAGTCATCTGGAAGCTGCCCGGATGGAATGTGTTGGAAGCTGCGTCTGGATATGCCGAGGCAATAACGGTGAACGAAGCCGAGTACAG
CGGGCTCTTGCTATGTTTTGACCTGCTAGAAGATCTCCCCAAGGAACGGCTCATTGTTTGCGGCGATTCCAACTTCGTGATCCGCCAGATGCGTGGTGAG
ATCGACTGCAAGGCCCCCGCGTTGACGCTTCTGCGACAGAAAGCCCTGACTCGTCTGCGGGCATGGCCACACCACGACCTGCTGCATGTCAAGCGTGCGT
GGAACGCCAGTGCCGACAGTCTAGCAAGTGGGGCTCTCCGACGGGAAGGTGGCGTCACGGTGGAATCGGATCCAGATCTGGAAGACCTGGTTACGCTAAA
CCGactggacgagatcctgaCCTCAGgaccagaagaagtcgccgCAAGGATCATCGTAGTCACTACCAGGGGACAAGCCAGGCGGGAAAGGCCGAAGGTG
CTTGACGAGGCAGCTATCCAACAACTACGGGTGGAGCGGATCCGACAAgcgcaggacgaggagtCATGGATCACCAACCTGAAGGCGTTTCTGCGAGGCC
ATATGGAGGATCTCAGCAACGCTGAAGCTAAGACCTGCCGTATGCTAGCTGANGTCATATGGAGGATCTCAGCAACGCTGAAGCTAAGACCTGCCGTATG
CTAGCTGATAAtttcgagctggacgacacTGGGTTGCTGTTCTACTGCTCGCCTTCTACGAAGGCGGATGCGGATCGTGACGGGCTGTTGCGTTTGGTTG
TTCCGGAGACACTTCAAGCAGATCTGCTACATCATTACCATGTCAGCTTAGAGGGTGATCACCAGGGGATTGGACGAACCTATCAAAGGATCAGGGAATA
TTTTTACTGGCGAGGGCTCTTCCGATCAGTGCAGAAGTTCGTCGGCGAATGCGTAGACTGCGAGACGGGCAAGGGGCGACCGACTATCAGAGGAGTGTCG
CCAGGCAACATTCGAGACACTTACCATTTCCAGGTCATAGCTATGGACCATATCCCGTCGCTGCCCAAGTCGATGAAGGGGAACACTGAGCTTCTTGTAT
GGGTGGACCTCTTCAGTGGATACGTGATGGCGAGCGCTAACGATTCCCGGACGGCTCAAGCGGTAGCGGAGTCGTACGAGGCATGTGTGTTCCGACGTTT
CGGCGCCAGCCAAGCGATCCGCCACGATCGTGAGTCCGGATTTATGTCGGACTTCTTTCGCGCCTTCAACCGGATCCTCGGCCAAAGACAGAAAGCTACC
ATGGCCTACCGCCCACAGTCTAACGGCACGGCGGAACGTATGGTGCAGACGATCATACGAGCCATCAAGATGTACGTCCAGGATCCCGACCAGCGAGATT
GGGATGAGTATGCCGAGCGCCTTACGTTCGCACTCAACACCGCGCATGATCGGACCAGGGGCGATACGCCTTTCTACCTGGTTCACGGGTGGGATCCTAA
GACTACGTTGGAGGCAACATTATCTCTGGGTAACACTGGACGTCGAGATGTGGAGCCACGTCGATGGAGATACCGGATCCAACGCTCCTACCAGTTAGCT
CCCGCAGAAATCAACGACCGGCTGAAGGATGCAATTACGGAACGCGCCGACCGGAACAACGAAGCCGCGACGGTGCACACCATCGAGACTGGATCTCAAG
TGTGGCTCTTCCTGGACAGAGTCAAGGAAGGAtacgcgaagaagctggccCACATGTGGCACGGCCCATTCCGAGTAGCAGAGATGGTGAGTGAGTATGC
GGTGCGCCTTGAGGTCACTGGAACGGATTACCACCTCTTCCCTGTGGTACACctctccaagttgaagccggTCAAGATCTTCCCGG