Description :
From Genome Similarity Track
Location :
Scaffold_3218:2- 2522
Sequence
2520 bases(100 bases per row)
CCAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGC
ATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATCCAGTGACCAGACAGACCTTAGGTGGA
TCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAGTAACCACGTGTCTCTCCTCTTTGTAGATCCAGGGTTGAAG
AGACTTTGGATCTGGAAAACTCGTCCACTTGGCGCAAACTAGAGACCCTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTAGATCTAGGGT
CCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAAAGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGT
TTAACATCTTCTCTGCCACTTCCGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCC
GACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCAT
CCAGATTCAGTGTGCTTCCGGGGATCCGCACTGCGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGT
ACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGCTGGACGCAGTGAGACAGACCCGACGGTAATCTTCAGGGTCGGAGTCCGAAC
CGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGTCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGA
TCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGAT
CCACATCTCCCAACGTCTTGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATT
TAGTCGATGTAGGTATTCCAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTTCCAATCCACAGTACTGGGTCTGG
AAACTGCGCAGCAAATCTGGCCACTTATCTTGGTGGATATGCCCAACTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACA
CTTCTCAGCATCCGATGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCC
TTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGC
CATCCAGATCATCTGGGTCGAACTCATCATGGAAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTTGTGCTCCATATTCGTGGAGCACTTGCACTTG
TGGCACGGGCGCTTTCATACCCTGTTCGGTCAGAAACCGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTG
GCCGTCTGGTCCACTGGCGAGACAGGGTCCGTGAGGCGATTACCTCGAGCCTGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCT
GGATGGATTGTGTCAGATCACGCGTAGGGCCTACTGGATCCCGAGCCTTCACGTTCACAGGGGCTTCCTGTCTTCGGACCCTCGCCCGCGCTTCCAGCAT
GGATGCCCCGGAGGGTCCTAAAGTCATGCGTCATGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTG
ATCCTCGGCGATGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCTGCGTCGCGGATGCTATGAGATCCA
GATCTAGCCCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGC
CGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTTAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCT
TGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTCGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAG
TCTTACTCGTTTCCGTCTTC