Description :
From Genome Similarity Track
Location :
Scaffold_1375:2- 2516
Transcript NameFunction/comments
Phyra_86911Cyclic nucleotide-binding domain containing protein

Sequence
2514 bases(100 bases per row)
ACCTCAGCTTGTCGCCGGTTTTCGGCTACGAGGACACCATCCAGCTGGCGTTGCCGAGCAGAGCTAGGAGGTGCGTCCACGTTGAACGACGTGACGTAGT
TGCCAAGCGTTCGGTCCGGGTTCAAACACTTTTTCATGGCCTTCGCTTCTTGTGCCAGCAGGAGTAGCTCGTTCGCAGGAACTAGAGCCTGTCTTGCCGA
GCTTACACCACTTGAACGAGATGAATCTAGAGCTTTGCCATCACCAGACGAAGGAGGGAGGGGTAACGCAGGTAGCGTGACACTTTCGACAGGAGACTGT
AACTCTCGGCCTGACCCAGGCTTTTTGGGGCTGGAAGAATTGATTCGGGATTCACTTCTTGTCGCGGTCGCTTGACGTGGCTGTGAAGTCTTGGCAGCAT
TCGTATTCTTCCGCCTCGTAGCCACAGCGGAAGGCAGAATTTTCTCAATGCGTTCATGGTTGACATGCTCTCGGAGTATTTTCTGCTTGTAAGCCTCCCA
TTTTTGCGTCTTGTGAAAGCGATCCAAGTACACGATGCTTTCTGCGTGTGACTGAGCAGCAGCTCGTAAGGTTTCACGTGCCGACCGCGACAGGCGATGG
AAAACATCATATTTCGATAACAGCAGGATTTCGACTGGGGTAGTTGCACTGACCGTCACTTCTCGATGGAGTACTTCGTTGAAATTTGTCCCAGCAGCCC
TACATCGACGCAGACCCCACACCAGTTAGAAGCCAGCAAAACGTACAGCAACCCGGGATACTACTACGTACGCATCATCGCCGAACACGTGGAAACGGCC
TATACGCTCCACGAAAACCTCATGCTTGACCTGGGTGAACGGATCAGTGATCTCTTTCGTGACGACCACTTCCCCGCGAACAACAAAATAGACGTGTGTT
GCACGGTCACCCTGTCTGTACAACACACTCCCTGTTGAAACCTTTTGCTCCAGCAAGACATAGGATAGCTCCTTAAGCAGTTCGCCAGTCCACTCAGGCG
TCTGGAACATTGGAATCTGGTCCAAGACGCCCACCCGCTTGGCCATATCCTTCTTCTGCATGCGACGAAGGGTGGCGTTGTAGTCCTTCTCACAGATCAC
CAAGAGCTGACACTCTTCGCGGGTGACCACCGTTGCACTGCGTACACCTCGGCCTTTCATGAGAGCCAACTCGCCAAAGTGGGAGCCTTCCGTCAGGTTG
ACAAGCTTCGTCATTTGCATATTGCCTTTGAAGTCCTTGGAATTAATGTTCACGTCCACAGATCCACTAAAGATGATGTAAAACAGGTCTCCGATCTCGC
CCTCGCGGAACACACAAGCTCCTGCAAGCAGCGTCTGGAAGTCTACGACAGTACACAGCTCGCGCACGAACGCTTTCGGCAAGCTTCGGAAGAACTTGAG
TGTTTGGAGGTACTCGCTCAGCATATCAATGTCGGCTTTAGAGCGTGCGTGCTTCTTTTTGGTCAGCACTTTGATGTACTCCCGCTGCGTCCGCTGTACC
GGACGTTGGACACCAATGCCATTGGCGATCTGCATACGCGAGAGGAACTCGAGCTGGTCATTCTTCAGCATGAGATTGTAGTCGTTCCGCGTGATTCTCA
CGAGATCAGTTGCAGTCTTTGACAGCACTGTAGCAGCACGGACGTCGTTATTGAGCAGCGAGCGCTCTCCGAAGTAGTCACCTTTACCCAGCTCGCATAC
GGTGACCTCAACCACCTCGCCAAGGATGCGTTGACTCACACGAACTTCCACAGTGCCGCTGAAGACAATATAAAGCGCGTCGCCTTCGTCTCCTTGCCGG
AAAATGATCTCGTCGGGGTGGAAGGATACGCAAGTCATGCGTTTGCACAGCAAGTCAAGCTCTGATGGCTGCAAACGCTCAAAATCTGTCGTGATTTTGA
GCTTTGTGGTCTGGAACCAAACGCCTAGTGATTGCAAGTCCATCTGAGAGCGCTGCTCGCCGTCTTGCGCAAGAGCTCGGCGGCAAGATTCCTCTAGAAT
GAGTGTGCGTCCATACAGTTGGTGTCCTTTGGCAGTGTCATCCAGGTCAAAGCCTGAATGCACCCCATTGGCGTCCTCCCACGTCTCGCTCTCTTCTTCT
TCTTCGTTGTTGCTGCTGTTGGGTCTGTTTCCACCGTCCCCTCCCTCGTCATCCGCTTCATTCTGCTTCCGCCGCAACGTCGACAACTTGATCCAGTGCG
ACATCACTCTCGACTGTTCCTCAGGCGCGCCTGTCACCCGACTCACTTGCTTGGCAACGAGCGCCTGCTCCACGAGGTTCTTCATCTCCCTGCTCTTGAG
CATCTGAGCCAGCGAAATGCGCTTTTCGGACGTAGCACCTGCACCGCTGCTCGGAGCAAGCCCAAGCCCCACATCTCGTGAAGCCTTGCCTGCAACAGTG
TTCATGACAGCCGCCCACGGATCCTTTCGTTCTGTCGGAGGTTGCGTCACGTTTTCGGTGGGTCTCTGCTGCTTGTGCATTGTCATGATGGAGTGAGCAG
CGCGACTGAAGCCC