Description :
From Genome Similarity Track
Location :
Scaffold_4079:2- 2446
Sequence
2444 bases(100 bases per row)
AGCGGAATGCTGTGGGAGTGTCTCGTGATGTCACATGGACTGTCGAATACCCCCAGCGACTTTTAGTCGCCTGGTGACACATTTTTCCATCCCTCCGTGC
CTTTGCGCAGACGTACTTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTCTCTCTGCTAAATTGAAAAAGTGCAGCTTTGGTGCAGATGAGATCCCTGTCCTCGGGTGTTTCGTCGAAGTCG
AGGGCGTTTGGGCCGACCCCGAAAAGATCAAGGCGATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCAAGCCTTATAGCGTCGTATGCGACGCGTCCAACTTTGC
TATCGGCAGTGCATTGATGCAACTAGATGGCGAATGTCATGAACGAATGGTCTCGTACCAAACTCGCCAGCTCCAGGCTGCGGAAAAGGGGTGTCCAGTC
ATGACAAGGAGTTGTTGGTGTTAAAGTACGACCTGGTGAGTTCCGTCTTCGCCTTCTCGACTCGCTGCTATTTGTGGTGTACACCGATCACCCGTCCCTC
CGGACCGCGACACAGCCTCCCCACCTGCCACCTGTCGCCGCGAATGGCTCGCTGATTGTCATTCTTTCAGAATGCAGCTTTACTTTGGAGTACAAGCCTG
GTTGGCTCAACGTACACGCGGACGCCCTGTCCCGCCGTCCGGATTATGAGATGGATCATCTCACATCAATCGCATCTGGCGTGTACGAACTGGTTCGTGA
CGCGTCTGGCGATGACACCCAGTGCTGAACGATCCTTCGCGCTCTCTTGTCGACTTAAGCTGTGACACGTCTGTCTCCTTGCGCGGACTCCATCGATACT
CCGTCCAAGACGGTCTCCTGATGTATCAGGTCACTCCTGGTGAGGATGGACGTATCGTCGTCCCGGCAGATGAAGATCTGCGATACGTCATCGCGTACGG
CGCCCACGACGCTCCGGGTGCGGGGCACCTTGGTCGAGAGAAAACCTACTCTCTCCTCTGCACCAGGCTCTGGTGGCCCAAGATGTACAAATGGGTCTCG
CGGTACGTCCGCACGTGTAACATATGTCAATGAGTGAAGCCAATCCTACACACGCAAGCCCCATTGCAGAGTCTACCAGTCCCCAGCGATTGCTGGTGCT
CGGTGAGCATGGACTACTTCTTAGGCTTGCTGCGAACGGCGGCCGGGCACGATGGTGTGCTGGTCTTTGTCGGCCGTCTCTCCAAGATGGTACATCTTAC
ACCGGTCTCCGACACGTGCGCAGGCTCTGACTGTGTCCGACTTTCCGTCGATGGGGTTTCCGTCTTCAAGGCCTCCCCGAACATATCGTGTCGGATCGAG
ATCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTCTTTTCCACATCTTGGGAACAAG
ACTCAACATGTCGACAACGAACCATCCGGAAACCGACGGTGAGACCGAGCGCGCCAACCGCGTTGTCGAGGATATCCTCCGCTCTTACTGTGCAGAGCAT
CCAGGATCCTGGCGCGACTCTCCCAATGGTCGAGTTTGCAGTGAACAACGCGGCCCACGCGCCGACAGGTCTGTCACGGTTCTACATCAACGGGCTTCGC
CATCCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGTAAC
TCAAGACGGCTGAGCGACTGAAGCTAGACGAGTTCATGTCGACTCGCGTGAGCGCCGTCACACGCGTCTGTGACGCCATGGCGCAAGTGCAGGGCGTTCA
AAAGGAACAACCTGACAAGAACCGTCGCAAGAACACCAATATGTTCAGATAGGGCGACTAAGTGTTGGCCAACACGAAGAACCTGTCTCCGCAAACTGTG
TCTAGCTTGGGCAGCACGAAGCTGCTCCCGATGTATATCGGTCCGTTCAAGGTCTTGAAGAAGACTGGTAACTCGTACCGGGTCGACTTACCCAGCTGGA
TGCAGACACACCCACGTTCTACGTCGGCTTCCTCAAGCCGTACC