Description :
From Genome Similarity Track
Location :
Scaffold_565:2- 2415
Sequence
2413 bases(100 bases per row)
ACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGCAATCCTGGGCAGAACAACATGGTAGGCTGTACGTTGTAGCAGCGCTGCGGCGGACTTGGTCGATG
GCTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGGGCT
GTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGTTGTTTAGGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATAGT
CGTGCTGAGCACGGACAATCCGACGTGGAAAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAACTTGTATGCCAACTTGGATA
AGTGCGTCTTTGGCGCGGAGGAAATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACTG
CCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCACAAGTACAGCGCAAACTACGCGGAGATGGCTCGGCCATTA
TTAGATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCTTG
CGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTTCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACG
CGTGATCGCGTTTGAGTCCCGCCAGCTCAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAACGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTC
AGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGAGCTTTACTGATCATGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCTCCGAGAATGGCAA
GATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGGCTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCAGACTACGAA
TTACCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATACGCGGAGCGTATGCACAAGACGACATGTGCGCAGCGCTGCTACGGGCTCTTGGGA
GCGAAGAGTTTAAAGACTCTGACAAAGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCGCTCGATGGTGGCCTGCTGTACTACAGCACCGA
CTCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAAGTATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGT
CGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGA
CAAAGCCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTACCTGTCCCCAAGGGATCTTGGCAGTCCATGAGTATGGACGTTGTGTTTGGCCTTCCCAA
GGATAAGGCGGGAAACACGGGTATAGTGGTCTTTGTAGACCGATTGAGCAAGATGACTCATTTAGCGGCAGTGCCGGACACCATTGATGGTGAAGGTACA
GCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCGGGACGTTCC
TCTTCAGAGTGCTCGGCACTCGTTTGGACATGTCCACAGCGGACCATCCGCAGACCGATGGTCAGACCGAACGCGTGAATCGCGGTGTGGAGGATATCCT
CCGAAGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACT
CCGTTCTATGTGAACGGCTTGGTTAGCCCTCGCGTCCCACCGACGCCGCCACGCAGTGGCTCAGGGCTTGATAAGGGAGGGATAACCGAGCGGCTAGCTG
ATGTCAGCCCTGTTGCGGTTCGCAAGCAAGTCAATGACTTTGTCTCTTTGAGACTAAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGA
CATGCAAAAAGAACATGCAGATGCCAAAGGCAGACGCAATGAAGAAAGGTTTGAGGTCGGAGACCAAGTTTTATTAAATGCAAAAAAAAAAAACTACCTA
CTCATGCAGTGTCTGCAGGATTTAAGACAAAATTGAGACCACGGTTCATAGGACCGTTGAAGGTCGTGGCCAAGAAGGGCTTAGCGTATACGCTTAACCT
TCCGAAGAAGATG