Description :
From Genome Similarity Track
Location :
Scaffold_151:2- 2368
Transcript NameFunction/comments
Phyin_T30-4PITG_20917Sulfatase-like protein

Sequence
2366 bases(100 bases per row)
GGATCAACGTTAGGATTTGACAATTGGCACACTCGCATGGCTTTGACAACGTATGGGACGCCGACAAAATGAAGAGAATGGCGGAACACATTTTAACATC
AGAAGTCAAGACTGGGACAATGACGAACACCGCGGTTTCAGCTGGGGTGCCCATGATGACCTCAGCTTCCGACTTTTAGGAGATTTTCTACTCGAAAATA
GACCAAAACAGGTCGAAAGGGCCAGACAAGGAGAGCCCAAAGTGCCCATGTTCGTCACGCATTACACCATTTCGAGTCATGAGCCTTATGACTCACTGCC
CAAGTGGTACGAAGAGTCCGAGAAACCAGACTTTTCGGCCATGTACGAAGGTGAACAGCACGCAGACAGGGTCAAAAGGTACATGAACGCGCGGTATTTT
ACCGATACGGAACTCGGCAAGTTCATGGACCGCATGCACAACGAGGGATTCCTCCACGACACCATCGTTGTCATCTTTGGAGACCACGGACAGGCACCCG
AGGTTGACAAGTTTAACGTGCACGAAGAGTCTGCGACGCGCGTACCTGCCGCTATCATTGCTGAAGGGCGATTGGGTAATGCTGTGGGGCTTGTGCTTAA
TGACGTAGCCGAGCAGTACGATCTTCTAAATACTCTCGCAGACATTACTGGGTTACCGAAGGGAGGATTCCAGCAAAATGGCGTCGGTCGGTCACTGAAG
CGTAAAGCTTCTTCCAAAAAGCATGTCGTGTATAGTAACGACCCGCTGCGCAAGATGGCGATTGTACGAGGCCACGAGCGTCTTCGTTATGACGAAATTA
CAGACTCAATGATGCTGCACGACACGGAAACGGACTTCCACATGACAACGGATCTGTTACCGCTCCTTAAACCAGAAGAGCGTGCTGAGTGGGAAGCTTT
GCGAGAGGATGGACGTCGCATTACCGCATACTTCAAGAAGCGGTGGGACGAGAACTGTCTCCTCGCAGTCCAGTGCGAGACCCTTAGTTGACACTGTCAA
CTTGACAGTTGACCTTACCGGCAAACCGGTAGCTGACATGGGTTTGAACGCTTCGGTCTTATAAGTAATTGGGTGGGATCGTCTCGTCGATGAAGAAGAC
GAAGCGGCACGTATGCAGACAGCGTTCTGGTCTGCAGTGCTCAAAGAGAAACGATGACGATACGCAGGAGTCCATCTCGGCGTACGAGCGAGAGGAAGCG
CAGAGTCGTATGTGGAAATTGGTTGCCTAGAATTTTTAAATGGAAGATCGCCTGAACTGCAATAGTAAAAAAACACATGCGGATGGGTCTATTGACACTA
GTTAAAAAAAATTCTATCAATATCGATCAAGCAGAGGTGCAAGTGCAACACGTTACATATGATACTATTGTGTACACCGCCATGCGGGCCGTAGTGGAGT
GTCTGCGCTCGATCCCAAAGCGCTTAACCCCGTCAGCTTGGTTAGCTCCGAAAAGGTACGTATACGGAACTGATCAGATTCTAGATCAGATATTTATCTT
ACTGGAGATCTGACATGGGATCTGAAAATGATTGGTAAGTTCACGCACTTCTTCAGCCTCGAGGCTGCTCGTGCGTTGGTCAGTGGAGAAGATAAATCAA
GAGGCAAACGAGGGCGCGTCGGTGGATGCCGAGGTGGAGCCTGCTGAGCCGGCCGAGAACGTCGTTAGCACTGAGTTGCTGTTCGAGCAAGCTCGACAGC
AACTCGCAAATGATGTGGGGTCTGTGCCACGACGTGGTGAGCGGACGACATGCTTCTACAAGGGCTATAAGTACTGCAAGGCATGGTCGTCCTCAAGGAA
AATTGTGTACAGATGCTCTAAGTTTCGCCAAGGTTGCAGAGAAAAGCTGGAGTTTACTATTGCATCGATGGTGTGACGGGGTCACACAGCACCTTGCGCT
AGAGGAAGTTATCTTCCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACAGGTCCCCTCTTTATTTAAAGAGAGCGAAGTGACCTAAATAAGGTAGA
TTGTAAACTGAGTATATTTATAGGTAGGTTAAGTTTGAGGTTAATACAAACTATCAGTTACCTATAGAAATGCAATGTCATTTAACCAATGGTTGGTTTT
GAATGACCTTGGTACCTTGTACCAAATATCCCGGAGTATGACATGTCATACTCCTGAAGTGTGAAGTGTCACACTTCATGTAACCAGGGTACACTTAGTG
CTACGTACCCCGTTACAGATGGCGTATGCTGCTGTAAAGCTGCACACATGCCGCATCGAAGCCATTGCCAACGTCGTCATCAACGTTGAGGACCAGATGA
AAGCTCAAGCCGACCTTCTTGCGATTAAGCACGTCGCTTGGCCTGTGCGCCAAGTTTGGGAAGAAT