Description :
From Genome Similarity Track
Location :
Scaffold_3060:2- 2328
Transcript NameFunction/comments
Phyta_totarag15040hypothetical protein PHYSODRAFT_332751

Sequence
2326 bases(100 bases per row)
GTTGTAGAACTCTTCCATCAGGCACTTGCCCACGTCATGGAGTTCACCACATCTGCGGCAGACAATCAGACAGCGATCTGACGGGTGTCCTTGTTTTCCG
CACTTCTGACAGGTCaggcgtctccagcagccaagaTCTGTGTGACGGACGGATCCGCAGTGCGAGCAGCGAGTGCGCCCCGAGCTACCACGTCCGGTCG
GAGATCGGCGCCCCTGGGGGTCGAATCCTCAAGGCTCCGGTCCGGCTGGCGGTCATCATGGCACCTCGCTTCGTCTGCAGGCGACTGGTCTGGATCAGCG
GCTGCAgtgatgtacatgtacacttggCGCAGATCACCGCTGGATCCTTCCGATCCACGGTCTTCAGGCTCGAATCCTGAGTCAGGATCCGGGATCTGGA
TAGCGCGTACAGCACGTGCAGGCGTCGTTGGCTGAGCCGGTGCTCCCGGTACTTGTTGGATCCCGACACGCGTTTCTCCTGTCGGGTCCTGGCACACTCG
CGCGCGCAGGACATCCCCAAGCTTGTCGGCGTCTCCGAGGCGTAGCAGCGTGAGCTGATCGACCAGATCCTGGTCGTCCAATGTCTCAATGAAGTGATCC
ACGTGTTCACGTCGATCCTTCGGCTCACCATCCTTGATCTTCAGGCGCGCTCGCATTCCGGCCACGTTCAAGCGGTGGAGGTATTCAAGTGGTGACTCAT
CCGCGCGCTTGTGCGCGTGGTAATTCTGCCACGCGACTGAAACCCTCAGCCCGCAGTACTGTGTCTGGAAGCTGCGCATCAAGTCGCTCCACTTGGTGCG
TATCGTACGCCTCAGTTGGCGATACCAGTTCTTCGCTGATCCTGTGAGAAGATCGGCGAAGGTCAGACACTTCTCTTCACCCGAGGCTTGGTCGCGCTGG
AACGCCGACTTAACCTTGCTGAGCCAAGCTCGCactcgctcttcatcgtgatCCTTGCCCGTGAACTCCTTCAAGTCGGAGATTGCTGAGATCCGGACTC
GCTGGATCATGGAGGGTCCGACCGAGccagctgtcgctgctgccacgacCGCACGTCAGTTGTCCAAACTTCGAGGTCGTCAGGATCGTACTCCAAGTGC
TGAAGGTCTGGGGTCCTGAccgactccatctcgacgtcCTGGGAGCCGGGCGATCTCGCTCGAGTAACGCCTCATGGGGTGGCTGATGCCTGTTGCTCAC
GCAGGAACCGGCTCATGGCAGACTGGAAATACGCCTCCAGTCTGTCTGTCGGCTCGTGTGGAGGATCCGCGACTGGGTGGGTTCTCCGGGTCTGTGGTCT
GGAGGGCCGTACAGGATCGCAGCATCGCTTCACCCGAGGGCCCAGGCGACATGCGTTGCAGATTACCGGGGCTGTCCGAGTCCACTTCCGACGTCGTCGA
GGCGTGGTGGGAGGATCCAGTCTGGTACTCCGGGGTGCGGATCTGGGGAGGCGGCTGACGATCCTCAGTGCGAGGCGCCTCGCCCACAAggatcttcagc
ttcccgGAGAGACCCACAATGGCAGTCTTGATCACGTCCAAGTCCAGGTTGATAAGGTCGTTCGCGTCGAACACCCCAGCAACGATGCCAGCTTCCTtca
gcaagcgcagcaagatCTTCACTGCGGCCAGCTtgttcgtcgtcgccagtGGAGCAGTTACGGGTCCCGTCAGATCCccaagcagctgcaactgcaagat
cTTCATCACAGGGTCGTGATCCAAGAACCAGTTCAGCTCCTTCCGGTGGTAGACGTCCTCCAGTTGGTCTTCGGTCCAAGTAAACTTCAATTCATCACGG
TCTTCACCTTCCGACTCTGGTGCCTTGAATTTCTTCCGCGCGGCCTTGCTCTTCGTGTTCTTGACGCAGTCTTGGAAGCCGGTGGAGCGATGGTGGGTGC
AGTTCCCTCAGTTTTCACTGACGGATCTCGATTCGCATCAGGATCCGCGGGGGTCTCCGGAGAGACCtggcgggggggggggggtcttcGAGATCTGGAT
CCGGATCTCCCTCTCTTCCGTCAACATAACTCCTCCCAGGGCTCTGTCGATCCGTGGATCTAGCTTTCAGCAACGTCGTTGGCGATTCAAATTCCGTCGA
CGCCTCATCTCTCGATTCCTTGCTCGCAAGCACATCTTCTTGGGATTCACGGTGAAATCCCTGGTTCGAATCCGGACACGCGCACCATTGTGGTGCagcg
ggatcagcaaaatctgcgaagttgctggatccgacttaccaacagcgcccagacaccgactaacggagggggtgctccgatgatccgtgatctgctgaac
tgtTCACCTTGTGTACTCGTCGGTGG