Description :
From Genome Similarity Track
Location :
Scaffold_75:2- 2312
Sequence
2310 bases(100 bases per row)
TGTTGTGGAAACACAGGACTCTGGCCCCAATGTGCATGATGCACATGCAGTTTCCACGAGTGAGAGCAGTGTCAGTCAAACGTCAAGTTTGATCGTTCTC
AAAGTTCATGTAGACGGTATTGCAACGCCTCTACGTGCTTTAGTTGACACTGGTGCGTCGAACAACTTTGTTCGAAATGAAGTGATCACCAGGCACAACA
TCTCTGTGCCTGTTGCGAATGAAGAGAAGATGATGATTGTTCGGTTGGCCAACGGGTCACTGTGAAGATGCCAAAGCGAGTTGTTCGCTTGGCAATGAAG
TATGAAGATTTCCGAGGTGAAGACGAGTTCATTTTACTCGACCTCGATGACAAGTTTGATATCATCCTGGGCATGCCATGGTTGAAGCGTTACCAACCTA
GCATTGACTGGATGAAGATGAAGATCTCCGTTGACAAGTCGTGCATCGCCGACTTGAGCTGCATGACAACGGATGAAGTGGTATGGGTTTACACATCTGT
GGGAGAAGTCCCAGATGGCCCTTGTGATATTGCGGTGTGCGATGGCCCCCCATGCTCACAAGCGGCACCCATTTTGAAGAAGACGAACGGAGGTGGAGCA
GTCAGGCGCCATAAAAAGACTGTCTCCTTTGCCATCGACGACAAAGTTGCGTGCGATGGTAGTGTGAAGAACGACGGGAAAAGAGGCAGAGACCCATCCC
AAGACAAGAAGAAGAAGACCAGCAAGAAGAGTGTTCCGCCAAGAATTTTGAGTGCCCCTGATCAAGGTACAAGTCAAGATGACGAAGGAAGTGTCCAAGT
AAGAGTCACTTCGAGCGAGTTTGTGAACCTTCTGGTCTCGAGCGAAGATGGTGACGTCGATCTAATCCGTCGCGCAAAGATTGAAAACCCTCCAAGTTCA
GTCGAAGAATTGATTTCCTTGCCATCGATGAGCAAGAAGACGCTGAAGCGTAGCCTAACGAGAGGCGAAATCTCGCAGATCTGCATGATCGTCGATGTTG
ACGATGCAGAGGACATCGGCACGGTATCAGCAATGGAAGCTGAAGTGCTCGATGGGAAGTCACGGAAAGGAAAGGTTTGATGAGCAGTCGTGGGACGCTC
TCAAGATGAACCCCGTGTATGGACTTGTCAAGGAATATGCTGACATATTTCCAGACAAAGTGCCGGACGACTGCCATTTGATAGAGCATTCGTCACGAGA
TTGACGTACTTCTGGCACGAAGTACTGTATCACACGACAGTGGCCGTTGCCAAAGGACAGTCGAGGCAATTGACGAGTTCTTTGCGCAACGCGCGAAGGC
TGGGCATGTGCGGGAGAGCAAGTCTCCGCATTGTAGTCCCACTTTTTGTGTGAAGAAGGCGACTGGCGGATGGCGCATTGTTCACGCTTTCAACAAGCTG
AACGACGCGACTATTCCTGCTCAGACTCCGGTTCCACGCAAGGATATGATCCTTGATGGGATGGTTGGCAGCACCGTCTTTAGTGCTATCGATCTGAAAG
ATGGATTCTATCAGATTCGTATGCGTGAGAGTGATGTACCATTTACAGCAGTAAGCACCCCTAGTGGTATGCTGTGGGAATGGTTAGTGATGCCACAGGG
ACTGAAGAATGCACCCGCGACCTTCAATCAAGTGGTCACGAACGTTCTTCGTCCTTTACGAACATTCGCACCGAGTTACTTCGACGATATCTTCGTTCAT
GTAAGGCCACGAATGGGAGATCTGATGTTGATGTTCATCTTGATCATCTTCGTCAAGTCTTTCAAGTTATGCGCGAGAACAAACTTTACGCAAACTTGAA
GAAGTGCATGTTCTTCTCCCCCGAGATCCCTGCTCTCGGTTGTTTTGTGGGCAAGAACGGTGTTCGAGTCGATCCTGAGAAGGTCAAGTCTATTGACGAT
TGGCCTATTCCTCAGAACGTCAAACAGCTACGTCAGTGGCTGGGTTTGGCCAACTATTTGCACAAATACACGCGCAACTACGCAGCGTTAGTGCAACCCC
TCACGAGTCTTTTGAAGAAAGAAAATGAGTGGGAATGGTCAGAGGAACATCAGGCAGCGTTTGCCGAAGTAAAGAAGAGCTTAAGAGAAGCTCCTGTCCT
AGCTCTCGCAGACCATGAGAAGCCGTTCCATGTAGCCTGCGATGCGAGCGATTATGCCATCGGGTGTGCACTGATGTAACACGATGATGAGGGCAAAGAA
AGAGTTGTATCGTATCAGTCACGACACTCAGCCCGCCGAAAGGACTATCCAGTCCACGACAGAACTATTGGCATGAAATATGCATGGCAAGTTCGAGTCT
ATTTGCTCGG