Description :
From Genome Similarity Track
Location :
Scaffold_3042:2- 2205
Transcript NameFunction/comments
Phypl_g15576hypothetical protein

Sequence
2203 bases(100 bases per row)
GCACTTCATCAGCCGTTTTACCTTCCGCAGCACGGCTGTGCACGAAGATGTCATCAAAGTACGTCTGTACAAACTTCCGCATCGGCCGGAAGAGCTGGGT
CACCAGTCGGTTGAATGTTGCTGGCGCATTAGAGAGCCCTTGGGGCATAACTAGCCATTCCCACAACATACCGCTGGGGGTACTCACCGCTGTGAGCGGA
ATGTCGGATTCGCGCATCAACAGTTGATAGTACCCATCGACCATGTCGAGCGCACTGTAGACCGTGCACCACGCCATGTTGTTTTGCAACACGTCCTTCC
GAGGGATTGGCGTTGACGCCGGGATCGTGGCTGCATTCAGCTTGTTGTAGGCATGTACCATGCGCCATTTCCCGTTGGGTTTGCGCACGCAGAACGTCGG
GGCTGAATGCGGCGACTTAGACTCGCGCACCATGCCTGCGGCATGCTTCGCCGCAAAGAAGGCGTCGATCACATCGACCTATTTTTTCGGCAGCGGCCAT
TGACGTGTGATACAGTACTTGGTACCCGGTTCCAGGTCGATCTCGTGTCGGACACCGCGATCCGGAGGCAACACTGACGGTGGGTCCTCCGAGACCACAT
CCGCgtactccagcagcagcggataGTACGGATCCGCAGGATCTTTCAAGATGGCCGCGACTTNtcccgcagcagcgaatAGTACGGATCCGCGGGATCT
TTCAAGATGGCCGCGCCATACGGTTGCTGCCGACGAGAGACTCTCTTCCCCCAACACCTCTTGGTCCATGACCGACGAGCTATTCAGCTCCACGGAGGTC
TGCTCCCGACGAGAGAGGACCAGGTCCTCTGGTTCTCCTGCTTTCAGCGACTCGAGAAACTCGACGTAggagagctcctcgagctccagtaGCTCCGACA
CCGCCGGGATCGGGGTGAGATCCATCCTCGTAGACAGCTTCCCGGTAAccgcgtcgacgacgacaatcGCTGGAGTAGAACCCGACGGGTCAACTTGCTT
TTCCCCAAGCGCGTCGACCTTGTACTTTGCTCTGTGGGAGCCTCTGCTCGACCACCTTATGTGACGCGACGAACCCtgtcagcgtcttcttctgcgtgaG
CTGTCTCAACTCGAACGCCTTGAACTGTGGGAGCGTCTGCTCGACCACTCTGAGTGACGCGACGAACCCCGTCAGCGTCTGCTTAGACGTGAGCTGCCTC
AGCTCGAACGCCCTGCGTCATGGGAGCCACTGCTCGATCATCTATAGTTTCTGGAACGCGCACTCCTTTGGCTGTACCGGCAAAGTGTCGCTCCCCGCGT
GACACACGGTGCTCGTGCACAAACCCGTCGCGAGATGAGGAGGGGACATGACCCGCCAAAACTCGATCCGCGAGGGGATGATGACTAGCACCTATGGTAC
GACTGCGCCAGTCGATCCACGGCGCATGCTTGGCTAGCCAAGGCATGCCGAGGAACAGGTTGCACcgctcgtccatgtcgagCACAATAAACGGTTCAAC
CGAGTTAAAGTCGTCAAACTTGACCGTCAAAGGGAGGAGAACCTTCCGCGTCGATACTGTCGAACCAGTCGCCAGGCGAACAGACACGTTGCTATTACTC
TTAGAGTCTTCTAAAGCTTTAGCATACAATGAACTGTTCTTAGCCACACTGGCTTTCGTTGCGAAATTGTACGACGGACTTGAATCGATCAGGTTGGTCA
TAGCTTCCTCGTACCCCTTAACGCTGGCGGTAACGAAACTAGGTTAGAcctcgcggccgccaccgaGAGACACAAAAGTGGCGTCTCCGGGACTTGCTTC
CCCGGACGGGAAGATGGCAAAGCCATCTTCCCGTCCGAGAGGAGCGAAGCCTCCTAGCAGGGCGTCCCACGCCTACTGGGAGTCGCCGTTTTCCAACAGA
TCGGACTCAATTACATTAagagacgacgacgtcgtagTGGACTTACCACGATTCACACGGCATGGGTTCGTCGGACAGTTGCGACGGATGTGTCCCAATT
CGTTGCAACCAAAACAacggccaccaccacggacCTTCCGAGGAGGGCGAGCCGATTCGGCCGAAGAAATCTCCATGGGAGTGGGACCTTCGGAGGCGTC
CGACCGTCCAGTGTGGCCCTGCGCAGAGCGCACACACTGGTCTTCCAGCATGGCGATGTGTACCGCTTCGTTGAACGTCTTCGCTTGGCGACGAAAGAGT
TCC