Description :
From Genome Similarity Track
Location :
Scaffold_1859:2- 2164
Transcript NameFunction/comments
Phypl_g14275putative polyprotein

Sequence
2162 bases(100 bases per row)
GTCGATCGCCCTGCCCGACATGGAGTCGAAGACCATGTCCTTCCGTGGGATCGGCGTCTGTGCAGGAGTGGTGACCTCGTTCAGCTTATTGAAGGCATGA
ACGATGCGCCATCCGCCTGTGACCTTCTTCACACAGAAGGTCGGACTCGAGTGCGGAGAGATGCTCTCACGTACGTGATCAGCCTTGCGTCGACCCTCGA
AGAACTCATCAACTGCCTTGACTTGATCTCGCGGCAGTGGCCACTGCCGTGTCACGCAGTATTTCGTGCCGGGCGTGAGGTCGATCTCGTGCCTCACGCC
ACGGTCGGCGGGTAACTCGGCGGGAATCTTGTCCGGGAAGACGTCCGCGTACTTGCGGGCGGTGTCGTACACTGGGTTGTCGGACTCGCGAAGTGACTCC
CGCGACTGAGCCGCGAAGCGCTCTTCGCGTGCCGACTTTGGCTCGGCACTGTTGGGGCGACCACCGCGTCTGCCTCGCTGACTGCATTCATCTCGTGAGT
CGGTGAGCTAGCGTCGGTGATCAAGCACACTTGCTCGATGTCACCAGgcttgaggtcgcgcaggaaatTCTCCCAGGAGAGTCCTGGTAGGCGCGTGACC
GACGCGGCGTCGCGAGGGGGACTCGCGACCTCGATGGTTCGGCTACGCTGCGTGGCACCTTCCGCGTACTCAAGTGCGCAGACGGACTCCAGCACAGCGG
GTTTGTTCTCGATGAAGTCGCGACGTGGCTTCAGGCGTCTATGGGAACGTCGAAATGTCTTCGTACGTTTCGAGCCCTTGCTCGAGACCGATgcttcgct
gtcgctggacgatgcTTCACCCTCCTCGAGGCGCGGGAGCTCGCTCTCGACCGCGCCGGATTCAAGAGGGAGGAACTCCTGCTCGACAGTTTCGTCACTC
TGCGGGAGTCGCCTtcgctcgaccgcctcgcTCTCATTCTCAGCCAGCGTCACGGCACATACCGTACAGAGAGGGCCATCGCTCACTCTTTGCAGGGCGT
GTGTCGTGGTGGATTGgtcgacgactcggacatgCGGCCAGTCCGACGGTGCAACCAGTAGGTGGGTGAACACCGCGCTGACGCCGAAGTCACTTCGACG
CTTGACTGACCGATCCAACCACGGTATCCCCAGGATGCAGTCGAATGCGTAGTTCATCTCGTAGACCAGAAACTCATCATTGCTCTCGAAGCCATCGAAC
GTGTACGGCAGCGCGACGGCGCGTCGCAGAACGCGGTGTGGCTTTCCGTCGGCCATCTTGACGAGGAGCTCACCCGGACCTTCGCGAACAGCGACCGTGG
GTAGAAACAGAGACAAGCAGGACGcgcggaagaagttgctcGACGCGCCAGAGTCCAGGAGCGCGCGGAGAGGACGCCGCGCGTCGGTGACGTAAAGACT
CACGATGATCAGCCTCGAGTcgccgctggtggtggtggcattGAAGTGTGCGTACTGCACGGGGGGGCTAGGAGGTTTGGTTGCCACCGGGGGACCCGGA
CCTCCATTCCAGCCGGTAGGGCTCCCCGCGCCTACTGGTCCCGGTGGTTTTTTTGGCTGGGCTGCCGGAAACGCAGCGTCGCTCCTGGGGACGACTGCAT
TCGCGAACACCGCCGTGCGATGACTTGTCTTGCCACAGCGGTAACAGTTGATCGAGCCAGGGCCACGACCACTGCGGTTGATTGGCCGACCGCGgtcacc
tgcagcgtcgatgGCATCAATCTCCATGGGTTCCGGGGCGGACACTCGCGCCTCTGACGATAGTGCTCGAGCGTACGAAGACGCGACCGTATAGTCCTCC
CGGTGCGCGAGGCCGAACGCTTCTTCCAGAGTCTTCGACTCGGCGCGCATGAGGCAATAGCGCGTCATTCCTTCACGCATCCCGCAGATGAAGACATGGA
CCTGCGACGCCATGTCGATCGGACTCGCGATTACACACGAGATGTGACGGGGGTCACACGCACCTTGGCTTGAGGAAGCGTAGCTTCTAACCGGACAGAC
GCCTGGCGTCTCTGTCGTCTTGTTCGCATGAGGAGGCCCTGCCTTCCTATGGCTTCTGGNTATTTACTGCCACACTCTAGTCCCTATTTACCGTAACTAC
CTGAATACTGAACCGTCCTTTAATGATTGTACCCGAATGAATGGCTGAGACTCGACCTACTG