Description :
From Genome Similarity Track
Location :
Scaffold_1705:2- 2151
Sequence
2149 bases(100 bases per row)
TTCAAGAAGTGTATATTTGCTGCAAGCGAAATACCACTTCTGGATGCATCGTGGGTAAGCACGGCGTCCGGCTCGATCCGGAAAAGATCAAGGCGATCAC
TGACTGGCCCGGTGCCTACCGACATAAAAGGACTTTGGAAGTTCCTTGGCCTAGCGGCGTATTTGCACAAATACTCGCACAATTACGACGAGATGACTGT
TCATCTCTCTCGTCTATGAAAAGAAGGAGAAGTGGGCATGGAGTGCTGATTGTCAGCGCTCATTCGAAGGTATCAAGCAAAGCTTGATAAGCTCGCCAGT
TTTGGCGATTGCAGACCAAGACAGACCATTTCATGTGGTCTGAGATGCAAGTGATTTTGCAATCGGCTATGCACTAATGTAGTACGACACAGACGGTGCT
GAGCGTGTCGTCTGCTATCAGTCCCTTCAGCTGCAACCAGATGAACGCAACTACCCAGTCCATGACAAGGAACTCCTTGCCATGAAGTATGCTTTGGCAA
AATTCAGGGTATACCTACTAGGTGATAGACCCTTCATCGTATACACGGACCATGCGTCCTTACGCACGGCCGTAAAAAGTCCACACCTCTCGCAACGAAT
GGCGAGGTGGATGTCGTTCTTCGCGGAGAATAACTTTTCCATAGAATATAAACCAGGACGACTGAATGTCGTCGCTGATGCACTCTCGCGCCGGCCCGAA
TTTCGAGCCGGATGCGCCACCCGACACTGGTCCGACCACTGTCGCGGTACTGACTTCAAGTGTCCCGTCGTCAACCTTATTGGAAGACATACGCAAGGCG
TACGATCTGGCGATGGTGCGTTTGATGGGTCATCTCTCGTACTCATCCGGAAAGAGCCTCAAACAGTTGCCGTCAGTATATCGATCCTCTACGGATAGAT
ATATAGTTCGCAACGGCTTACTCCAATATTTGGCTGTTGCCGGCGACACACCTCGTGTCTTCGTACCAGATCATGGTGATCTGCGATTGCGTATCATTTA
TAAGTACCACGACGCACCTGCTGGTGGACATTGTGGTCGTGAGAAAACATATCTCACAGTGTGCCGCACCTTTTACTGACCCCGCCAGTATCAGTTCGTG
CGCAAGTACGTTCGGGCATGTGAAGTCTGTCAACGGGTGAAATCTGGTCCTTCCCTTCGAGCCCCGTTACAGCCTCTGCCCGTCTCGGCCAAGTGCTGAG
AATCCGTCTCAATGGACTTTGTCTTTGGATTCCCCGTAGATCCACACAAGAATACAGTTATTCTTGTGTTCGTTGACAGGTTCAACAAGATGGTACATCT
GGTTGCTGTACCCGAATGAATCAAAGCATCGGCTTGTGCCCGTGTCTTTATCGACACGGTCTTTCGCCTTCATGGGTTGCATCGTGAACTCGTGTCCGAT
CGGGACCCACGGTTCAAAGCTGAGTTCTGGCGTTCTGTGTTCAAAACATTCGTAACGCGCTTAAAGCTGTCTACTTCTGACCAGCATGAATCAGATGGTC
AGACTGAACGCGCCAATCTTGTCATCGAGGAGATCTTTCGAGGATACGTCCATTCCTTTACGAATTGGAGCGAATTCCTGTCAATGGTGGAGTTTGCCAT
CAACAATTCAGTCCATGCGTCGACGAAGCACACACCGTTCTTCGTGAACGGCTTACGATATGCACTTCTTCCCACCTTTTTAAAGTGTGACTCTCGTTAA
GGAGGTGACTAATTCGAGCGACCGTCAATCCGGGCCTCACTCGTCACGTGCTGACAATGCGGTCACCACAGTCGACGCCGATGTCGATCACATCGGCTTT
GGTGAAGACGACGAAAGTAAGAGCGAAGATGCTCTTACTGGCCACGATACTGATCAGATCAGCATCACGCCTAGTGCGTCCAAAGACACACTCATAGAGG
CGACAAGTGATCTTGCTACAGTACTCTCCAAAAGCACTACATCCAAATACAGCGAGTCAGCAGATGAATTCATACTGGCTCGCGAAACGGTTGTCCGTCT
CGTACAAGACTCCATTGCTGAAGCAGTGGACCGACAAAAGAAAAACGAAGACAAGAATGGAAAGGCAAATGTTCTTTTATTCAATAAAGGCGACTTAGTC
CTACTATCTACGGTAAACCTACCTCGACACATAGTGACTAACGTGGGTA