Description :
From Genome Similarity Track
Location :
Scaffold_3768:2- 2124
Sequence
2122 bases(100 bases per row)
AAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAAAGAGCTGTTGG
AAGATTTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCAT
CACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCGATAACGCTCTCTATGGATTC
ACCCGAATACCGGAACCCAAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTAGATTCATTTGAGGCAGGAGAGCCCGGGGATCCTGGAACCCCGTCCG
TGTTAGGACGCAGATCTCACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAA
GTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGCTGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCT
AAGGACCTGTCTTCGTTAGCCGATTTGTCCTTCCCGCAGTCGTTACGGGCGATACAATCCTTCTTGGGCAGTTTGAACTACAACAGTCGGTTCATCGAGG
ATTACGCCCTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATCAAAATCCAACAAGCTCTGGC
CCGGGAGATGTCGGATCCACGAAGGGATCCAAGTGGTACGACGTCAGAAGAGGACCTAAAACAGGAGTGGATCCACCCCGGGACCAACGCAGAGAGGATC
CAGTCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGAC
CACGCCTATCCTCCGTCATTTTGATCCGGAACGTCAACCTACGGTGATAGTTTATGCCAGTGACTTGGGCAACTTCACGCGACCTCTGGTAACAAGAAAC
ATGTAGGGATCTGTCATCCAGTCACTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGC
GTGCTGGATCTGAATTACAACCTGCTGGTGAGAAGATCCATCCGGATCCTGTCTCGACACTCTACACTAGCCTGGCTGTTGAAGTCGGCCGGTTTACAAG
GACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACACTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAG
CATCACACCTCGAGCTAAGATGGATGAGGCGCTGACTAGGATCGCTCCTAAGAAAGAGCTTAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGCG
TATGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCAGAGGAGGAGCATACAGCGCAATACTGTGGAGACTGCCCAGATGGGAAG
TGGTACGGGCCAGGTCCACTTACGCGGAAGGCCTCACCGTCAATGAAGCGGAGTATAACGGGCTCCTTCTGGGTTTGGATCTACTAAAGGGACAAGATCC
AAAAAGGCTGGTGATTTGTGGGGATTCAAATTTGGTGATCAGACAGGTGCGAGGCGAGATTGACTGCAAGGCCCCGGCCCTAACGCTGTTACGGCAGAAA
GTGATGATCCACCTGCGTGGTTGGATGAATCACGAATTAGTACATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGTTTGGCCAGTGCTGCTTTACGGA
ATCAATGTGGTGTCGAAGTCGAGAGAGAGGCCGAGTATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTCGTAATTGGATCCGGGAAAAGGAC
AGTCCAGGTGATGGCTATCACTAGGTCCAGAGGAAGGATTGGATCCAGCCCCCAGATTCTCGAGGAAACATTTGTGAAGGGAGTCCGCATTGAGCGGATC
CACAAAGCACAGAATGAAGAAG