Description :
From Genome Similarity Track
Location :
Scaffold_2927:2- 2097
Transcript NameFunction/comments
Phyta_totarag14941hypothetical protein

Sequence
2095 bases(100 bases per row)
tgttgtgtttgttgctaaaggttccacatctgacgaattgtgtgttctgcaataccacactCGTCATAGGCGCCGTGGTCATAACCAGTATCTGGTGAAG
TGGTGTAGGGAGTCTCACTCGCATAACTCGTGGGAGTACGAGGTGCCACTGAGATAGGACTGTCCTGATGCCGTGGACGCATTTGATCAAAGCGCCCTGA
ACCAGAGCGAGGACTCGCGACCACGTCGTCGGTCGCCTCCCGCTTCCCAACGCTAGTCTGGGAAGCCTTCACGTCAGTCGCCGAGCTCAGGCTCTAACGT
tgagctgatgcagcagtcTCTCTGGTGTAAGGAGTTGCTGGAACAGCAGGAGCGGAAGCCCCTGGGGGCGGGGGCGATAGACCGGGGCAAACTGCGTTTC
ACCTAGAAAATTGCATACTCAAAGCGGAGTCGCCTTTCGAGACGAACCCCGCTACGCTGAAGCTTGCTTGAAGCGCATAAAAGGAACATGTGATCTTCAT
GGAACATTTACCGCTGCTGTGTCAAGTTTGAACAAGATCGACGAATATTCGCGATCCAGTGTGACGATGGCCTTGGACATTCGCCAGGAGAATCGCGTAG
ATACTGGAAGCACCACGTGCCTGACAAGAAGTTCAAACAAGCGAAAGCTGTGGGGAAGATCAACAACGAAAAAGCAACCATGTTGTTTAACAGTGGTGCC
GAGGTGTCTATTATTGACACAGCATTTGCTCGTAAGGTTGGGTGCTACATTAACGAAAGTCAGACGCTGGGGTGTGAAGGTGTTGGAAAATCCCCATACA
CGGCAGACGGACGTACCAGACTCAATATCACGCTCGCTGGATCGTTGATctacttcttcgacgtctGGGTAGGCCCNAGCCGGTAGACGACCACTCTACG
GAAAGCGTGTGGAACAGGTGACCTTGAACGAAGATCGACATGTCGACGTCGGAGGATCGACGGAGGTGAAGCTGCGAGCCGATAGTCGGAAGCTGTGGAT
AACCCGCGGAGATCGCTGGGTGCCTACCCTGATAGCAGGCCCTGGCAAGACACGCTACCTGCAGCTGACAAACATGAGCGATCGCGAATTAGTACTGGAT
CGCAACATGCGCGTCGGAATGTGGCTGGCCGGAGATCGGGTGCCCCGCTTACCTGGATATATATCGGTGAGATCGTGTAGGTATGCCGAATGGCAAAACC
TGGCCTATCAGGCGACGgtagatgacgacgaagatcaCCAGGAATTGGAGGAGCCACAGGAACCCGCCGTGGATCGGTCGCAGTACAAGACTCCAACTGC
GATCTTGCCCCGGCCGCCGGAGCGACTGCCAAAAGTAGCAATGCtcggtggtggcgacgactGAGATAGCGGAGAACACGGTCGAAGGGTTCTGCGAGAA
GGCGCCCCAACAACGGAAGAAACGCGAAGAAAAGCGGGTCTGTCGCCGGCTGGGAAGGTACAAGTCAGCGTCAATGAGTGTATTAAACGCCCAGTCCCTG
GTGCAGAAAGGGCGATGTATGCAAAAGATTGCATTCAAGTGATTGCAGATGTCAGGATTCAAGTGATTGCAAATGTCAGCATTCAAGTGATTGGTAAGAT
CGAGGCGCAGAGATGGGTGAAAAATCAGAAGCGCATTCTAGATCGACCTGCAAGGATTGGAGAAAACGATGAGGCACTGGGACAGGACCCGGACGAGAGT
AACCAAGATCTCGCTGATGATTACGTTAGAGAacatgcagaagacgaacaGGTGTACatcaaagaagaagatgagctTTACGCAGAAGATCTCGAAGGGC
ACATGGCGGTACTGCCGGAGATCACGCCGACGACGGAAGAAGTCAAGATCGAGGATATCCAGGTGGGAAACCCTGAGGACAGTACGCcggaagagatcga
gcgaCAAGTGAAGATCATCTGGCGTCGCCTACACCTTCTAATTGAGAAGGGGAACGCCTTGCCACCTGCTGCGAAGGGTGCGATCTGCGACATTGATGTG
GAAATGCAAGACCAATAGCCCAACGGATCCGCAAGATCGCCCCGCAATTTCGCGAGAAgctgttcctgctgatcAAGGGTTTGCTGTCAGCCGAG