Description :
From Genome Similarity Track
Location :
Scaffold_1342:2- 2095
Sequence
2093 bases(100 bases per row)
TTGGGTTCGCCATGTGTACTAGCGTCGCCGGCCTCCTTTCTCTTTCGATCCTTTGTCTTCGTGGATCAGGTACCCGTGTTTTCGGGAAGCCCACCATGTT
GATCGAAATGGACCCCTAGCGAGTTTAACCCCGACGGCTCTGGTTTGAACTAGGTGTTCCCACTCTCGATAAGAGATCCAGGCACTTTGTCCCATGAAAA
AGCTAGGATCCACTTGTGGGGTAGCGGGATCTGTGCGACCCGGCTTCAGCTCTCTGCGACCCCCCCATCCACCGACCCTTGGTTACCTAGGGACCGGCTC
TGGGTATCACCAGCGGTCTTGGATCCAACCTCTACCACTTGGATCCGAATCCGACGATCCCTCTGTAGGATCTTTCGCGGAGTTGAATATGAAGGCCGAT
CCACCAAGGGACCAGTTGGCTCCGCCGGGAACTCCACCTCCCCAAGCGATTCGATATCGGTAGTCGCCTCGTACGCCAGATTCTGCCATTCTCTGTAGCG
ACGGGATCCCACTGACATATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCGCCCAATCTCCTCATAGTGGTCCAGTAATAGTCTCTTGTCG
CTGACATTCGTGACTTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACTCTAGGCACCCACTTCTCACCCCGAGTGACCCACTGTTTCTCATGTTCCA
TCCACTTCAACCGATGTGGCAGATCCCAGGTCTCTCCGGGCTCGATCCAGGTCGCCTTACCTGCCCTTATGATCATCATCGTCGCCCCGTACAACGGTCG
TCGTCCGCTGAGCTGGATCCGCATCTCGTCCGGGAAGCACGGTGTCCCATCTGCCAGATCCAACCTTACTCCGGCCGGTACCATGAAATCCATCCCGAGG
ATGGCGTCTTGACCCGCGAGATCTCCAACCCAAATGTCGAACCAGTATACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTTGTACGGT
ACACGCCTTCACCAATCCCAACACAATCTCGGATCCGACTCCCATCCACTTGGCACCCAACCGTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGC
ACCACTATCTAAGAGTAGGATTGCCTTTTATTGTTGACCTTGCCTCCTACTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCTGGATCCATCTCA
CCAACTGCGCCCGGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGCGCTTGTGGCCTTTCGCCACAAATG
ACATCAAGCCCTGGTCTGCAAAGAAATTGAACCGGGGTTGCCATCGCTACCATGAAGATTACCGTTCTGTTCACTGAGCTGCCGTTCCGGACTGAGTAGA
CTTTCCCTCGCGAAGAGGATGACATGCCGGCATCCGGGTATGTGGACTCGCTCGTCACCAGATCTCACGTGGAAGAGCTACACAGTGCCGCGCCATGGAA
TATCGTTTCGACCACTTTGGTGGATTACGTTAGCTTTCGAGGTGACGTCGGGGAACGCCTCGGGTTGTTCGTTGGTGCCTTCCGAGATTTCGTTTCCAAA
CACCGGATTGCCATATGGGAAGGCTCCCATCGGTTCCCCGTTTCTCGTGCCCAAATGCGGGATTCAACATGGCTGTTGAACTTAACAAGCAGCGCGGCAA
CCGACGCAGTCACGCTGGTCGAGCCTGGAAGCAAGTTCTCGCGATCCTTGTGCTGGCAATTTAAGACGGTTGGTGTGACGTGGATATCTTGCTGGATCCA
CTCTTCGTGCACCTTCCCGGACGTGGGGATAAAATGACGTGGTTTCCAGGATCCGTGTCTCGTCAAGCCAACTTGGAGGATCCCAACCTCCACCGCCCGG
AACCCACGAGCTTACTGGAGGCTCTGCGAGAGATCGACGAGGCTGAGCCTTGGCGCAACCAATTTCGGGGGGACCCCAGCCAACATCCCGGACACCGGAT
CCAGTGTCTGGCGGGCAAGTTCTTCAACGTTCAGTCCAAGACCACCTGATCCATACCGCTCATTCATGCTGCGCCTCCAGTTCCAGTCTTCGT