Description :
From Genome Similarity Track
Location :
Scaffold_1909:2- 2065
Transcript NameFunction/comments
Phymu_g13747hypothetical protein

Sequence
2063 bases(100 bases per row)
CCACAGACGGATGGTCAAACTGAGCGCGTCAACCGAGTGGTTGAGGACGTGCTGCGCAGTGTTTGCGCTGAGGCGCCGCGCTCTTGGTCGGCGCAGCTGC
CTATGGTTGAAATCGCACTCAACAACGCGGTACACGCGTCTACGGAGCTCACACCGTTTTACTTGAACGATCTTCGGAACCCCCAGGTGCCGCTCACACT
GGGTGGGGGCACCGAGGCTTTAAGCGTAAGTGGGGGAGAGGCTCGGAAAGAACTTTCCTCCCAGGTTTCCGGTGTGGAATCAGCCGCAGAAGTTGTCGAC
ATTTGTCGGCAACAGGCTGAATATGATCAGCCGGTTGCGTGATGCAATGGCTCTCGCACAGGACAAACACAAGGAGTACTCAGACCAACATGGAAGAGGA
AACTTAAACGTGTTTAATGGGGGCGACTTAGTGCTACTCGACACTAGGAACCTACCGCTTAATACTGGTTAACTCGACAGTGAGCAACAATTTAAAGCAT
GGCTTCATTGGACTCTTCAAGGTCCTCAGTAGGCACGGGGCTGCCTACACGATCGACTTGCCTAAGTCGATGACGACCCACCCGAAGTTTTATGTAGGTC
GACTGAAGCGGTACCATGACCCTCAAGGTCAAGCGGCTCCTCGAGAGGAAGAGAGTGACCgcgaggaggagagcgagcCTCCTCGAAGCGAGGCGGAGCC
TCAGGCACAGCGCGTCCCAGAGCGTACGGAGTCGAGTAACTCCCAGGGGCTGCGCCGTACACCTGTGAAGGGTACGGGCGGTGAGAGTACACCGAGGGGC
CGACAGCACGAGCCCCATAGCGCGAGTCGTGGAAGGACGAGGAATACGCATTCGGTTGCGGCTCCCGACAGGGCGATACCGTCTGAACCTCTCGATGGAG
GGTCTCAAGATCGTGCGACAGAGCACTACGGTCTACCCGACCATGGAGAGCCTGTATCTAATGATGCAGGTTTCCCAACTGGTGCAAGACGCCAGGCTGG
CCAgctacaacagcagcttggccgTCCTCCCCAAAACCAAGGGCAATCTTCAGTGCAAGGATACGCCTTCGGAGGAGACGGATCTTCTCCTGTTGCAGAG
CAACAACTTGTTCAAGAGACAGTGCCGAAGGCTGCGGAGCCTCCGACATCGAGTTCGACTCGAACGAGTAGTCGGGCGAGGGCCCCTCCAGCCTTGCTCG
ACCGGAATGGAGAACTCCACTATCACGTGGAGTGGGTTCTCCAGGAGCGGCGCCACGGTGAAACGTGCCAGCTCCGAGTGAAGTGGCGCGGGTACCCTGT
GTCACAGAGTACCTGGGAGCCGACCGAGCGGCTCCAAGTTGACTGCCCGAAGGCTGTCGCGTACTGGGAACAGACGCGGCGACAGCCTCGTAAGTAGTCC
CCGGCTTCTTAGCCGCAGTACGGGGTTGAAGCACCGCCGACTGTGCTTCATACCCGCGCTCATCACGAGCGCAAGACTGAGACTCAGTTCTCAGTCTCTC
CATCTCGCGATGGAGCAGACGTTTGCCCACAAGGTGGACAAACTGGACACGAAGGCTCCGGAGCTGGAGGGTGTGCTCCAGCTGATCTTCGTCGCGGAGT
TCGTTGTACTCCTGGGTTGACTTGGCTGTCAACCGGACCAATTGCCAAAAGAGGTCTTAGGCGTCAAGCCACGAAGTGGTGTTCTCAGGGAGAACCCACG
GATAACCCCACGCGGGCTTGAGACCCCCTTTGGTCTCGGGCTTCTTGCGAAGCGTGGTGAATTCCTTGAGAGGAATTCGGTGCTGTGCTAGAAGCACGCA
CCTGGCAACCGATAGGTTGCCTTGGAAGAGAGGTTCGTTTTGAACCAAGGCCCGCTCATAGGCCTTTGGAAGTATGGCCTCCTATGAGAGGACGCGGGTC
CTTAAGCTGCTCCAGAtaggcagcagctcccgaGCCATGTTCGGGCGGGTAGTAGCCTCTCTGGTGGGCAGAGTCCGCATCGTGCTGATGGCACCCACCT
GCGGCCGTAGGCGCGGCGCGCAATGGCTGCTGGGCAGCTTGAtagagctcttgctgctcgtcg