Description :
From Genome Similarity Track
Location :
Scaffold_2989:2- 2055
Transcript NameFunction/comments
Phypl_g15539hypothetical protein

Sequence
2053 bases(100 bases per row)
TTTACAccacaggcggctttgccgcagagaagcaaacaaataacagttcagttttagcatcaaagagtgtatttaccttgggttaagaataccgactctt
tgagtctctagttagttatactagagtgatctaagcctctgcggagacttaggggttcggagaaccgccagctgagattcggagagtcatacgtcttcct
ctgacgtactacgctacgcagccccgctgcactCACCGCTGTGAGCGGAATGTCCGATTCGCGCATCAACAGTTGATAGTAACCATCGACGATGTCGAGC
GCACTGTCGACCGTGCACCCCGCCATGTTGTTTTGCAACACGTCCTTCCGAGAGATTGGCGTTGACGCCGGGATCGTGGCTGCATTCAGCTTATTGTTGG
CATGTACCATGCGCCATTTCCCGTTGGGTTTGCGCACGCAAAATGTCGGGGCTGAATGCGGCGACTTAGACTCGCGCACCATGCCTGCGGCATGCTTCGC
CGCAAAGAAGGCGTCGATCACATCGACCTGTTCCTTCGGCAGCGGCCATTGGCTTGTGGTACAGTACTTGGTGCTCGATTCCAGGTCGATCTCGTGTCGG
ACACCGCGATCCAGAGGCAACACTGACGGTGGGTCCTCCGAGACCACATCTGCGTActcccgcagcagcggatAGTACGGATCCGCAGGATGGCCGCGCC
ATACCGTTGCTGCCGACGAGAGACTCTCTCTCCCTCCAACACCTCTTGGTCCATGACCGACAAGTTATTCAGCTCCACGGAGGTCTGCTCCCGACAAAGG
AGGAGGTCCTCTAATTCTCCCGCTTTCAGCGACTCGAGAAACTCGACGTAggagagctcctcgagctccagtaACTCCGACACCGCCGGGATCGGGGTGA
GATCCATCCTCGTGGACCGCTTCCCGGTAactgcgtcgacgacgacaattGCTGGAGTAGAACCCGATGGGCCATCTTGCCTTTTCCCCAAGCGCGTCGA
CCTTGTACCTTGCTCTGTGGGAGCCTCTGCTCGACCTCTTTGGGTGGTGCGACGACCACTgtcagcgcctccttctgtATGAGCTGTACCAGCTCGAACA
CCTTGCGTTGTGGGAGTTTCTGCTCGACCACCCTGGGTGACGCGACAAgcgccgtcagcgtcttcttctgcgtgaGTTGCCTCAACTCGAACGCCTTGGA
CTGTGGGAGCCTCTGCTCGACCACTCTGAGTGACGCGACGAATCCCGTCAgcgtctgcttcaacgtgagCTACCTCAGCTCGAGCGCCCTGCGTCATGGG
AGCCACTGCTCGACCATCTATAGTTTCTGGAACGCGCACTCCTTCGGCTGTACCGGCAAAGTGTCGCTCCCCGTGTGGCACACGGTGCTCGCGCACAAAC
CCGTCGCGAGATGAGGAGGGGACATGACCCACCAAAACTCGATCCGCGAGGGGATGATGACTAGCACCTATGGTGCGACTGCGCCAGTCGATCCACGGCT
CATGCTTGGCTAGCCACGGCATGCCGAGGATCAGGTCGTACcgctcgtccatgtcgagGACAATAAACGGTTCGACCGAGTTAAAGTCGTCAAACTTGAC
CGTCAAAGGGAGGAGAACCTTCCGCGTCGATACTATCGAACCAGTCACCAGGCGAACAGACACGTTGCTATTACTCTTAGAGTATTCTAAAGATTTAGCA
TACAATATACTGTTCCTAGCCACAGTGGCTTTCGTTGCGAAATTGTACGACGCACCTGAATCGATCAGGATGGTCATAGGTTCCTCGTACCTCTTAACGC
TGGCGGTAACGACCACAAGGTTAGACTTCCAGCCGCCACCGAGAGACACAAAAGTGTCGTCTCCGGGACTTGCTTCTCCGGACGGGGAGATGGCAAAGCC
ATCTGCGTCCGAAAGGAGCGAAGCCTCCCAGCAGGGCGTCCCACGCCTACTGGGAGCCGCCGTTTTCCGGCAGATCGGACTCAATTACATTGAgagacga
cggcgccgtaGTGGTCTTACCACGATTCACACGCCATGGGTTCGTCTGGCAGT