Description :
From Genome Similarity Track
Location :
Scaffold_3798:2- 2047
Sequence
2045 bases(100 bases per row)
TCTTCTCCTAGACATGGTCCATTGCTCTCTGGGTGGTTACTATTGCTGGATCGAGCTCCGCCGCAATATCCGCATCCATCACACCGTTTGGCCCTGTCCG
AGTGGACCCGGATGCTCGTTCGGATTGAAGAACGCACCCCAGATCTCCCAACGTCTAATCGATAACGCCCTCTATGGGTTCACCCGAATACCGGAACCCG
AAACGGGTGGATCCCGGGGAAAGCCATACGGAAGTGGATCCATTTGAAGCGGGGGAGCCAGGGGATTCTGGGACCCCGTCTGAGTTAGGACGCAGATCTT
ACATCGACGACATTCTGATCCCGGCGGAATCGTGGGATCAGTTGTGCGAGAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAG
TGTGGTAAAGAGCTATTGGTGGATGCGCAAGGTGGAGTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTA
GCCGATTTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCG
CGGTATTGTACGAATTGAGAGAGGTAGATTCTGCCGCGATGACCACTCCAGCTGTCCAGATGAAAATCCAACAAGCATTGGCCCAGGAGATGCCGGATCC
ACGAAGGGATCCAAGTGGTAGGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCAGCCCGGGACCAACAGAGAGAGGATCCAGGCTGGATAGAGACG
ACGGATCAGAACATGGAACAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGAATCGCGACCACGCCTATCCTCCGTC
ACTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGTTCAAGAACATGAGGGGATCTGCTATCCAGT
CACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCACTCCTGCGCGTGTTGGATCTGAATTACAAC
CTGCTGGTGGGAAGATCCATCCGGATCCTGACCCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAG
CTTTACTCTCGCCTTGGACGCTGGAGATTGTGAAATGCTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGAT
GGATGAAGCGCTGACTAAGGTCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGCAGACGAGGATCTGTACGTCCTG
AGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCAATACTGTGGAGACTACCTGGATGGGAAGTTGTACGGGCTAGATCCACTT
ATGCGGAAGGCCTCACCGTCAACGAAGCGGAGTATAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCGAAAAGGCTGGTGATTTGTGG
GGATTCAAATTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGT
TGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCCGATAGCTTGGCCAGCGCCGCTTTACGAAATCAATGTGGTGTTGAAGTGG
AGAGAGAGGCCGAGCATCAGGATCTCGTTACGCTGAACTGACTAGACGAAGTGGTGGTAGTGGGATCCAGGAAAAGGACAGTCCAGGTGATGGCCGTCAC
TAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTCGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAA
GCGTGGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACG