Description :
From Genome Similarity Track
Location :
Scaffold_3804:2- 2039
Sequence
2037 bases(100 bases per row)
GCCCCGCTGCCCGCCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAACCGATCGCTCAAAGGGTGCGGAGGGTGGCGCTCAGATCCGAGAAAAACTA
TCGGATCTGATTAAGGGCTACTGCAAGCCAAGATCATCAGCTTCTCAACGTCCCGTGGGACATCTCCGGTGGTAATACATACATCAAGAAGAACCGGATG
GATATACGTCTGTGCATTGATTACCGGCTGGCTAACAGCCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATTTGGATA
AAGTACTCTGGTACTGTTCTCTAGACATGACATGTGGTTTCTGGGTGGTGACTATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCGTTTGG
CCTGTTCGAGTGGACCCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTGATCGATAACGCCCTCTATGGGTTCACCCGAATACCG
GAGCCCGAAACGGGTGGATCCGGGGAAGGCCATACGGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTGGGACCCCATCTGTGTTAGGACGCA
GATCTTACATCGACGACATTCTAATCCCGGCGGAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCTTACTGGAGGCGTGTACTAAGTGGAATATCTC
TATTAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGAGTACTTGGGCCATCGAGTTTCTAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCT
TCATTAGCCGATTTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCCTTCTTGGGTAGTTTGAACTACTACAGTCGGTTCATCGAGGATTATGCCCTGT
TTGCTGCGGTATTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTACGGATAAAAATCCAACAAGCTCTGGCCCGGGAGATGTC
GGATCCACGAAGGGATCCAAGTGGTACGACGCCAGAAGAAGACCTAAAACAGGAGCTGGATCCACCCCGGGACCAACGGAGAGAGGATCCAGTCTGGATA
GAGACGACGGATCGGAACATGGAAGAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGACCACGCCTATCC
TCCGTCATTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCGGTGACTGGGCGGTCTCAGCAGCTCTGGTGCAAGAACATGAGGGGATCTGTCA
TCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAGCTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAAT
TACAACCTGCTAGTGAGAAGATCCATCCGGATCCTGACTCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGT
GGCCAGCTTTACTCTCGCCTTCGACACTGGAGATTAGGAAATGTTCGAAAGGGGAAGACAAGATCCTGGGAGTATTGGCCGCGAGCATCACTCCTCGAGC
TAAGATGGATGAGGCGCTGACTAGGATCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGCAGATGATGATCTGTAC
GTCCTGAGTTTCGATGGACCCGCTCGCGTACGATGCGGAGGCGGGGCGTACAGTGCAATACTGTGGAGACTACCTGGATGGGAAGTTGTACGGGCTAGAT
CCACTTATGCGGAAGCCTCACCGTCAACGAAGCGGAGTATAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGATAAGATCCGAAAAGGCTGGTGATT
TGTGGGGATTCAAATTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCTCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGC
GTGATTGGATGAATCACGAGTTGTGCATGTCAAGCGA