Description :
From Genome Similarity Track
Location :
Scaffold_204:2- 2023
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_204-snap-gene-0.9Callose synthase

Sequence
2021 bases(100 bases per row)
TGGATCGGCTGGTGGAAGGGCGAGCTCGAGCCGTTCTACAACACGAAGCCTGTTGCGCGCATCACGGTTTTGCTCCGCGAAAGCCGCCACTTTATCCTGC
TGTGGTACGTCATCACGCTGCAGTGGAGCAACCTCTGTGTCGCGTACGTGTTTGGTGCAAGCGTCGCGTCGGTGATTCTCTTTGGTGTGCTCGGCGCCAT
GAACCTGACCAGCAAGTGCAAGCCGACGACGCGTGCGATTCTGTACGGCGTGACGATCGCTATCGCTGCGACCGTCTACTTTGTGACGGCGTCCTACGCG
CTTGGCGCCACGAGGCGCTCGGCGCTGTCGATCTTTTTCGGTTACATGGCGTCGCTCTACGGCATTAACGAGATGGCCCGCATGTGGAGCTTCCACGACT
CGTCGATCGGCACGATTGGCATGTTCCAGCAGCTCGCCTTCTTTTTCGACTTCATTTTCAGTGTCGCCATGATCATTCCGCTCTTCATCATGTCGGGCAT
TCCGTTCCTCAATGTCGTTCAGACGCGCATGATGTACAACAAGGGCTTTTCCGAAGTCGTATCGGCCTCGTCGCAGTACGCGTTCTCGCTCGCGGCCTTT
ATGGGCATGCTCGGTGGTTTTGCCTGCGGCTGGCTCTTCTACCTCTTCACGACACTCGAGACGTCGCCCGACTTTGTTGGCTACGTCACGACGTTCAATC
TGCTCGGCGACAAGGCCGGCAATGGCTCGGTCACGTATCTCTTCTACGGTGCTGCCGCCGGCGGCACTGCGATCTCGGGCGTGCTGAACTACTTCATTGG
CCGACGTCTCTCGATTGTCGGTGGTGGTCTGCTCACGATCTTCGGCATGATTTCGGTGAGTGCCGTGCAGTCGTCGGGCGCCGGCTTTTTGCGTCCGGGC
ATTGCGCTCTTGGGCGCGGCCGTGGGGATCATGCTGCCGACCATTGCCATGTACATCTACGAAGTGTCGACCCGCGAGATGCGCGGCAAGGCACTGCTGC
TGTTGGGGTTCGGCTTTATTATCGGCACGCTTGCTGGTGCGTGGTTCACGTCGTCCAAGAACTCGATCGGCTGGGTCTGGCAAGTGTTCGTGGCCTCGAT
TGTCGTGTCGATTGTGACGCCGGCCGTCTACATTTTCCCCGAGAGTCCCTACTGGGTCTACAACCGCGAAGGGCTCGAGGCACTGGAGCGGTGTCTTGCT
GTGCTGCGTCGCAAGGACGGTGTTAAGGTCGAAGTGGATGCGATCCGTGCGGAGGAGGCCGTCGAAGACGATGGCGCGGCGTCGACATTCAAGTTTTTCA
TTGGGCTCTTCAGTATGCTCGTGTCGTCGCTGGTCTATGGCGGGCTCGCCATGTACCTGTCGCAGAAGTTCTCGTCGTTTACCGACGGACAGTACATGTT
CCTCAACTGCACGTCGCTCCAGCTGCTCGGCGCGCTCTTCTCGTTCTTTTTCATCGACAAGGTGGACCACCGCAAGATCATGATGGTGACGCTCGTGCCC
ATGGCAGCGCTCGTGGCGCTGCTCGGCGTGAACGCCCAGGCGCGCATGTGGACGGACGACGACGAGTTTCTCATGCTCCAGATTGTCGGCATGCTCGCCT
ACTTCTTCGCGGGCCTCGGGCTCTCGAGCGTGCCGTGGCTCACGTGCGTCGGCATGTTTACGACCGCCAAGCGCGTCGTGTTTTCCACGCTCTTCTTCGT
CCTGTTCTTCCTCCTGCCCATGGTGCCGCTCACGATCCGCGTGCACTCGGACGCCGACAAGAACCGCGAGTTCATCTACCTCTACGCGCTCGCCGGCTGC
AGCGTCGTGCTGCTGCTGCTCTTGCTCGGCGCGGGCGCGCGCCGCAACGGAATGGTGTGCACCAAGAAGGAGGCCGAGGACGAGCGTGTGCGGTTCCGCC
GCGATCGCCAGTCACGCCGCAGCGCACGCACGCCGGGCGCACGCAGCCGCAACTTGAGCCGGTCGCGCGCACGGTCGCAGTCGCACTACACAGTCTTCGA
GTCGCCCGCCGGCGGCGCGCC