Description :
From Genome Similarity Track
Location :
Scaffold_2463:2- 1987
Transcript NameFunction/comments
Phyag_g12500PREDICTED: uncharacterized protein LOC101313525

Sequence
1985 bases(100 bases per row)
CCGAAGGGTttgtcgttcttcatgaGATCCCGCAATGTGACATCCACCGCCTGAAAACCGTACTTGATCATCAACGGAGCCTCATCCACACAATCAATGA
TGTTTACCTGAGCGGTTCCGCACGGTCGGAGCCAGTCGTCACGTTACAGGTAGACGTAGAGGTGAGGTCCAACCCGAGTTGGAACGTATAGTGTGCCGTT
CTACCTCCCTTTAATTGTGTCGCAGCAATTCCGCTTGAAGCAGCTGCCACCGCGATCTTCCCGTCCAAGCAAACCGTCGCTAGAATTGTCTGCAGTAGGA
ACGACTTACCGGTACCTCCAGGGCCATCCAGAAAGAATAGCTTCTCATCAGCATTATCACAGTGGATAGTGTTGATTACCTTGTCATACACCACCCTTTG
GTCGTCATTTAAATGCCCTGCTTGAGATTTCAGGTCTTCCATTGCTGAGCGATCGTAAGAACTCTCCGTCTCGATCAACCGATTTGACGCCGAGTCATTG
GGGTGGAGATCACCGAAGTCCGACAGCTTGGGTAGCCCGTGGAAGTCTTCAATTTCCTTGTTATTGCTCCGCAAACACTGGTCAACAACTCGAACAGTAA
GGTAGATCACCTCTTGACTCGTTACCGGTTGTTGACGATCTAACTGGAAATCCTCGGACATGTCAGTCAAGAACGTGTCCCACAGAGCCTTTGGAGAACT
GGGATGGCAATGCACCAAGATAATGGCAAACAGGTGCCGAATCTGGCTTGGCATCTGGTGCTGACTTGCTTCTTCCATACATCGGCGCCAttcatcgtcg
ctctccaaAAGTCCCCttgcttgagcagcagcttgaaacGTCTCATGAACGGTTTCATCCACCGTTCGAAGGTCCTCAAACGATGTCGGTCCTCGTACGT
TGCACAACAGCATTTGAAGATAAAAGCGCTCTGTATTGTTGGGTGAAACAGAGACCATCCGGCCAATCGCCTTTTCACTGCCTCTCGTCCTGTGCTTCCA
ATTCTTGTTTTCCTTGACCCAGGTGTAGTGACGTGGGAACTCGTAGTAAAGTAGCTCTGTAGCATTGGTATCCGCAGCACACATTTTGAAGAACCTTGTC
AGTATTGTATGACGCTGGTTGGGAATTCTTTCTGGGTGTTCAGGATCAAATATAGTATAGTTCATTTCCGGTAGATGAACTGTCAACTGGATCACCGCAT
GTGATTTCCACTGCATTGGATACTTCAACATACGCCAACACGCCTCAGGAGGACAGATATATCGCCCACTGAGATactcctccacttcgtcgaTATCAAC
ACGTCGAGTGGTGCTGTCGCCCACATCAGTGACGGGCGCCTCCACAGAAAACGTAGCCCGATCTTGTCCCTTGTAGATGtacttgtacatgtacttgatc
GCGTTGATCGTCGAGCAGATCTCAACGTTGATGTGACAATTATACTTCTCGCACAGGTATGGATTGTACGGAACCACCCAGTGGTTGTCCAGCTCGACGT
TCTTGTGCATGGTTGATCGGTCTTGGTCTCTCCGTCTATACTCTGGGTAGCCACTTTCCTCACGCGTCGTGTCCGTGTGGAAACGTTTAGGGTAGCCTTT
TGAACAGACACCATCCTTCATACACGGAGCTTTAGGGTTGAGCACGCCACATGGTCCATGCATCAAGCACTTGGTCACTGTTTCGTACAATTGCGGATGT
GTGTTGGGATCTGGGAGCTCAGCGCACACAAACTTGTCGTAGTCCTCGGGACGTCTTGGGCTCGAGTCTTCCGTAAGCTTCACCAACATGTGAGCATGTG
GTAAGCCTCGTTTCTGGAACTCGATAACGTAGATCAGTGCCTGGACTTTCCCAAAGACTTCGTTCTTAATGATATCATCCTTAATGACCTCCAATTTCAG
CTTGAACGCTCGAGCAACCAAATCCGGGCGGTCNATACCTGGCTTGTATTCCACTTTCGTTGACCATCCTTGTTCTCCATACGGA