Description :
From Genome Similarity Track
Location :
Scaffold_3211:2- 1987
Transcript NameFunction/comments
Phypl_g15692hypothetical protein

Sequence
1985 bases(100 bases per row)
CTCGCATTCCTCGCGGCACGATGCggtcaagatggagacgtCGACGTATACCGGCGTCGGCCAAGATCGTCTCCCACTGAACCGCTGGTTccgcgagatc
gacatcgcGATCGCTTCGAGGTTGATCGAAGCATCGACGGCGAAAGTCAACTTTCTGTTGTCCCGCTTGTCTGGAAAGGCCAAGGAATGGGCCCTTGGCA
AGCTCGTCATCGATCAACACGCGTTCCCGACTCTGGAGAGTCTCCAGAGTTTTCTCCGACTCGCGTTCGAGCCTCCCCAAGACGAGTCGAGCATGAGTGC
CGACTTTATCGCTCTCAACCAaggcaagacgacgatgcgCGACTACGTTCAGAAGACACGGCACCTGATCTCGTGTGTCATCACGAGTCCGATCGACATG
ACGTCGCAGGTCCATGTATTCGTNGACGCGCTACTGTCTCACGCGCGCCGAGCCGAAGACTCTGGAAGAAGCGTTCGCCTTCGCGCTCTGCGAGGACGCT
ACGGTCGCGTCTTCGTACGCTCGAGCACTTTCGTCTGAGGCTCGAGTGTCCGCCCCGGACCCCATGGAGATTGATGCCATCGACGCCGCAGGTGATCGCG
GTCGGTCATTCAACCGCGGCAGTCGTGGCACTGGATCCTTGAACTGTTACCACTGTGGCAAGCCGGGTCATCGCGCGGCGGTCTGCCGCGCGCCCGCGCC
GGTGTTCGTGAACGCAGTCGTCCCTAGGGACGACGCTGTGTCCCCGGCAGCCCGGCCAAAAACCGACCGGGACCAGTAGGCGCGGGGCGCCGTACTGGCT
GGAATGGAGGTCCGGGTCCCCCGGTGGCAACCCAATCTCTTAGCCCCACCGTGCAGCATGCACACTTTAAtgtcaccaccaccagcggcgACTCGAGGCT
GATCATCGTCAGTCTTTACGTCGCCGGCGCGCGACGTCCNNNNNNNNNNNNGGGGCCACATGTCCGAGTCGTGGACCAAACCACCACGACACACGCCCTG
CATAGAATGAGCGATGGCCCTCTCTGTACGGTATGTGCCGTGTCGCTGGATGAGAACGAGATcgaggcggtcgagcgaCGGAGGCTCCCGCATAACACCG
ACGCGGTCGAGCAACGGAAGCTCCCGCATAGCAACGAGACGGTCAAGCGACGGAGGCTCCCGCATAATAACGTGGCGGTCGAGCGACGGAGGCTCCCGCA
TAACAACGAGGCGGTTGAGCGAAGGCGACTCCCGCAgagtgatgaagctgtcgagcagGAGTTCCTCCCGCTTGAATCCGGCGCGGTCGAAAACGAGCTC
CGGCGCCTAGAGGAGGGTGAAgcatcgtccagcgacagcgacgcatCGGTCTCGAGTNACGAAGACATCACGACGGTCGCGTAGACGTCTGCAGCCACGT
CGCGACTCCATCGATAACGCAcccacggtgctggagcccGTATACGCTCTCGAGTACATGGAAGGGTCTCCACAGCGCAGTCGAACCACCGAGGTCGCGA
GTCCTCCTcgcgacgcagcgacgaTCACGCGGCTACCAGGCCTCTCCTGGAAGaacttcctgcgcgacctcaagGCCGGCGACACCGAGCAAGTGTGCTT
GATCACNAGaacttcctgcgcgacctcaagGCCGGCGACATCGAGCAAGTGTGCTTGATCACCGACGCTAACCCGCCGACTCATGCGATAAATGCAGTCA
GCGAGGCAGACGCGGTGGCTCGCCCCAACAGCGCCGAGCCGAAGTCGGCACGCGAAGAGTGCTTCGCGGCCCAGTCGTGGGAATCACTTCGCGAGTCCGG
CAATCCAGTGTACGACACCGCCCGCGAGTAAGCGGACGTCTTCCCGGACAAGATTCCTGCCGAGTTACCCGCCGATCGTGGCGTGAGGCACGAGATCGAC
CTCACGCCCGGCACGAAATACTGCGTGACGCGACAGTGGCCACTGCCGCGAGACCAAGTCAAGGCAAttgacgagttcttcgagg