Description :
From Genome Similarity Track
Location :
Scaffold_2466:2- 1949
Sequence
1947 bases(100 bases per row)
GGTTATGACCCCCTTCCTGAGCCATGTGCTAGGGGCTGGTAAACGCTCTGGAGGCCAGGGATTCGAACGGGAAGTTCGACAATCGCTCGTGTGCGCTTTT
CAACCCTGCTCCTAGTGGAAGCTTTTGGTGAGTCATGAACCCCACCTTCTGCTAGGAAAGCAGAAGGCGGCTTTTGGCGCGAGCACGAGGCCGAGGCCGG
CCGTAGTGCTGGACATTGGTATGTCCCGAAATTGTTAGCAACGAGGTTGCTGTTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCCGCGGAGGGGTG
CAGGTCAGGTCAATGACCAACTGCTGGGTCCTGGTGAGGACGAGCGCGGAGTGGCGCGTAATCCACTGAGTGGTATGAATCTGGTCGATGACCTACCGCT
GCGTGACCCTAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTGGCCCAGGAGATGCAGGTGAAGTGACACCTAGCTCACTGTGTGAAGGTCAA
GAACCTCTTGGCTTTCAGCCGAGTGTCTTGCGAGACACTGTATCCTCTTCGAGGAGTGATGGTGCTGCTGCACCCGGTGGTAGTGACGGAGATGTCGCCA
CACCGCCCTCATCCGGCCGGGCTCGGTCGCGGAGGGAGAGGAGAAGAAGACGCAGGGCGTCTGTGACGTCTTCGACGTCGGACGATGTGTCCAACGTGTC
GAGCGGTGATGCTCCACGTGATTGCTGTGAACAGCTGTATACACTCGTGAACGGAGTGACGGGGGAGGTAGAAGGCGATATCAGCCTTGATACTCTGCCC
GCTGCAGATGCTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTTGGCGAAGCCTTAAAGGCAGACGAGCTAGCCGAGGTGGTCCTGCTGGGACCTG
AGGAGGAGTTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTAAAGGACACCAAGAAGGCGCTGAGCGCAACAAGTGGATCGGCGATCATCAAAGATCC
TTCGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCGATTAACCCACCGACGGGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGATT
GACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGAGAGAGCTGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGC
CAGGGATGGTGCGCGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGTGTCAGAAAGCCGAACGGCAAGCGGCGCATTGTTCATGCTTTTAACAAGCA
AAATGCGGCCACTATCCCGGCCCAAACGCCGATTCCTCGCAAGGATGTTCTGCAAAACAACATGGTAGGCTGTACATTGTACAGCGCGCTCGACTTGGTC
GATGGCTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGAGATGCCCATGG
GCTGTCGAACGCACCAGCGACGTTCAATCGTCTTGTGACGCGGTTGTTTAGGCCCCACCGGGCGTACGCTCAGACGTACTTTGACGATATATTCGTCCAT
AGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGTCAACTTGG
ACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGAGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGTCATCGTGGA
CTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCACAAGTACAGCGCGAATTACGCGGAGATGGCTCGGCCA
TTATCAGATCTCCTTAAGAAGGATGCACCATGGTGCTGGAACGTCGA