Description :
From Genome Similarity Track
Location :
Scaffold_2004:2- 1898
Transcript NameFunction/comments
Phymu_g13815pol protein

Sequence
1896 bases(100 bases per row)
CCGAACGGAATTACCCCGTTCACGACAAGGAACTCTTGGCGATGAAGTACGCCTTTGTCAAGTTCAGGGTGCATATTCTGGGCACAAGGCCCTTTGTGGT
CTATACACACCACGCGTCCCTGGTGACAGCCATCCATACACCGCATCTATCGCAGCGGATGGCGCGTTGgctgtccttcttcgcgGAGTACAACTTCCGC
GTTGAATACAAGCCTGGGAAGCTCAACACCCTTGCCGACGCTTTGTCGCGCAGACCCGACTATGAGTTAGCTCATATTAGTCGGGNAAGGTCGAGTGGCT
TACGCCTCGACAGCGGGCACGGCTTCACCGCTATGAGTGGGGCGATGGCCTACTCCACTATCGGGTGGAGCCCGGGGATCCTCCGCGAGTCGTTGTTCCA
AACGACGAGGATCTGAAGTATGATATACTTCATGAGGCACACGACGTGCCTTCGAGTGGCCACTTGGGCCGAGAGAAGACCTATCACGGGGTCTCTCAGT
TGTTTTGGTGGACCCACATGTACAAGTGGGTGACCAAGTACATCAAGACATGTGAAACTTGTCAGCGCGTTAAGCCGGCGGGGCACGCGTCGGCTCCACT
GCAGAGCCTGCCAGTCCCGCTGgactgctggaagtcgaTGAGTCTCGACTTTGTCTNGTTGTTCCTTGATAGCGTCTTCCGCTATCACGGGTTGCCTGAG
ACTGTTGTCTCTGACCGCGACCCGCGGTTTACCGCTGCGTTTTGGAAAACGCTGTTCCAAGTGCTTGGAACACGGTTGACGATGTCAACGGCGGACCATC
CACAGACGGATGGTCAAACTGAGCGCGTCAACCGAGTGGTTGAGGACGTGCTGCGCAGTGTTTGCGCTGAGGCGCCGCGCTCTTGGTCAGCGCAGCTGCC
TATGGTTGAGTTCGCACTCAACAACGCGGTGCACGCGTCAACGGGGTTCACGCCGTTCTACTTGAACGGGCTTCGGAACCCCCAGGTGCCGCTCACACTG
GGTGGAGGCACCGCGGCTTTAAGCGTAAGTGGGGGAGAGGCTCGGAAAGAGCTTTCCTCCCAGGTTTCCGGTGTGGAACCAGCCGCgttgcggaagaagt
tgtCGACATTTGTCGGCAACAGGCTGAATGTGATCAGCCGGGTGCGAGATGCAATGGCTCTCGCACAGGACAAACAAAAGGAGTACTCAGACCAACATAG
AAGAGGAAACTTAAACGTGTTTAATGTGGGTGACTTAGTGCTACTCGACACTAGGAACCTACCTCTTATCACTGTTAGCTCCACGGTgagcaacaagttg
aagcatCGCTTCATTGGACCCTTCAAGGTCCTGAGTAGGCACGGCGCTGCCTACACGATCGACTTGCCTAAGTCGATGACGACCCACCCGACGTTTTATG
TGGGTCGCCTGAAGCGGTATCATGACCCTCAGGGTCAAGCGGCTCCTCGAGAGGAAGAGAGTGGCCgcgaggaggagagcgaACCTCCTCGAAGCGAGGC
GGAGCCTCAGGCGCAGCGCGCCCCAGAGCGTACGGAGTCGAGTAACTCCCAGGGGCTGCGCCGTACACCTGTGAAGGGTAAGGGTGGTGAGAGTACACCG
AGGGGCCGACAGCACGAGCCCCATAGCGCGAGTCGTGGTAGGACGAGGAGTACGCATACGGTTGCGGCTCCCGACGGGGCGACACCGTCTGAACCTCTCG
GCGGAGGGTCTCAAGATCGTGCGACAGAGCACTACGGTCTACCCGACCATGGAGAGCCTGTATCTCGCGACGCAGGTCTCCCAACTGGCGCAAGACGCCA
GGCTGgccagctgcaacagcagcttggccgccCTCCCCAAGACCAAGGGCAATCTCCAGCGCAAGGATACGCCTTCGGAGGAGACGGATCTCCTCC