Description :
From Genome Similarity Track
Location :
Scaffold_2980:2- 1896
Sequence
1894 bases(100 bases per row)
TGTGCAAATTGAGTTCTGTATTGATATTTAAGCCTATACTTGCCTGGGTTTCTACCTTCTATGTCTTTCATCTGCTAAATCCCTTACCAGGCTCGGCTGC
ATGTCCCTTCTTCCCTTGACCCATCATCCCAGCTGTGTTATCTTCAGATCCACCGGATATATGACGTAATCATCATGGTCACCCTATTATGGGTACACTC
ATCCGGATCCAGGTCGCTTGGATCCACCTCACTGTAATGGTACACTCGCCGTGGATCCGAGCTCTCCAATCATCCAACATCATCTCGCAACCGTCTGTGA
TCTCCGTTGTCCCACGAAAGTTCGAGATCCACTGTATCCCTCATCCCTATACCCTGGATCCAGGTCCCTCCAGGCGGGATCCTCCCTCCTTGGATCCGAA
CTCGGAAGTATGGGATCCGGGGTACCTCGCGGTGGATCTTGACTCTTCATTAGCCGTGGCTACTAGATCCACCGTCAGAGGGCACCGACCATCCTTCCTT
CATAGGATCCACACTCGATCCACTCTTGTATAGTATATCCCATATCCATCTTAGTGAATCCAGGTAAGGGTGGATCCGAGGTAAGTCTTGGTGGATCTTG
CCTTCTCGTACATCGCTCATATCAGATCCATCGTCATATCATACGGGGTGCTGCTCGCCATGGCTAATCCACCACAGGCAACTTGCACCCGTGCCAAACA
ACCCAAATCCTCTATAATCACTTGAAATTGTCACTGATTCGGGATAGTGACCCCGCGTCAGGACCATTCTCTTATTTCTGAGAAAGCACTTCACCACAGA
TCCATGGATCTGCTAACCGGGGAGTCCCGTGGGTACTGGAAGTACCATGCCCCAGAAAAATGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATG
AAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCA
AGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAACGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGG
GTCGGGGATCTCGCTGGTCAAGACGCCATCCTTGGGATGGATTTCCTGGTGCCGGCCGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTG
ACGAGATGCGGATCCAGCTCAGCTGACGGCAACCGTTGTATGGGGCGAAGATGAGGATCATAAGGGCGGATAAGACAACCTGGATCGAGCCCGGGGAAAC
CTGGGAACTGCCAGATCGGTTAAGGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTACCTACCGTAATCCAGGGGCCAGGTCGA
TCACAATACCTCCAGGTCACGAACGTCAGCGATAAGAGACTATTACTGGACCATAATGAGGAGATTGGACGATGGTTAGCGAAGGACGGTATCCCTAGGC
GACCTGGATATGTGTCAGTGGGGTCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCTCTCGCAGAGGTGGAGCT
CCCAGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAATGGAA
GTTGAATCCAGGACGGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAAGCCGAACAGCCGGATC
CCGCTGATCCACGAGTGGATCCAAGCTTCCCATTGGATAAAGTGCCTGGATCCCTATCGCGAGTGGCAACACTAGTCAAACCAGAACCGTCGGA