Description :
From Genome Similarity Track
Location :
Scaffold_1796:2- 1894
Sequence
1892 bases(100 bases per row)
GGAACCAAATAATGCGTCACAAGGCAGTGGCCTTTACCAATAGAGAAATGTGACGTCATTGGCGAGTTTTTCCGTGCTAAGCACGTGGCTGGGATAGTAC
GTTTGAGTAATTCGCCTCATTCCACGCCAAAATTTTGTGTCAAAAAGCCGAATGATAAGTGGCGTATTGTACATGCTTATAATAAGCTTAATGCGACCAC
TATACCGCACAAACACCCATTCTTGGAAAGGACGTTCTTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTGGTCGATGGTTA
CTACCCCCTGCTCATGCGAGCAAGAGATATCCCGCTCACAGCGGTTTTTACGACAAGCGGTATGCTTTGGGGGTGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTGCCCCGGCGACATTTCATCGTCTGGTGATGCAACTATTCCGCCCTCACCATTCTTATAAAAACATATTTTGATGACATATTTGTCCATA
GTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTACGAGATGTGATCTAGTGCATGCGCACCAATAAGCTGTACTCTAATG
CATCAAAGTGCATTTTTGGTGCAGACGAGATCCCATTTTTGAGATNNNNNNNNNNTTGGGAAGCGATTCCTTCGGGTGGATCCCGAAAAGGCGAAGGTCC
TAAAGAATTGGCCAGTTTCTAAAAACCAAAAGGATCTGCGCAAGTGGATTGTCCTTGCCTATTGCTTGCTTAAGTACAGCGAGAATTAAGCTGATATGAC
TCGGCCATTGTCGAATCTCCTTAAAAANNNNNNNNNNNNNNNNTTGGACTAACACCAAAGATGATGCTTTAAATCATTAAGGGAGCATCTCCTACATGCC
ACGGTTTTGGCTTTGCCAGAACCTGATCGGCCTTTCAGTGTCGTCTGGGACGCNNNNNNNNNNTTGCCATTGGCTGTGCTCGGTTAAATACAGATGTTCA
GGGACGCGAGCGTGGCATCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTTTAAGCACTGCGACTCAGATGCCTCACCACTCTCAAAGATGT
CCCGTTGGATTTTATTCTTTGCAGAATATAACTTTGAGGTGAATTATAAGCCGGGGATGCAAAATATTATTTTTGGCTTATGCGTTGTCACGCCGACCTG
ACTATGAGCTTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATAAAAATGTCTAGCTTTTATACAAGCTCTTGG
GAGAGATGAGTGTAAAGACTCGGACATTAAACTGTCGGCACGTTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGCTTGTTGTTCTATCGCAC
GGATGCTACGGATACTTCGCACGTCGTGTCGTAATTCCTCATGATAAAGAACTGAAGTATCGAGTCCTCTATAAGGTCCATGAAATAGCGATTAGCGGTC
ATCTTGGTCGTGGGAAGACCTACGGCTGAGTTAGCCAAAGTCATTGGTGGCCCAAAGTCTATAAATGGGTAAGCGCTTATGTGGAACGTGCCAATGGGTC
AAACCCTCGACACATGCGGCTGCGCCGCTGGCTAGTTTGCCTGTACCCTCCGGATGTTGGGGGTCCATCAGCATGGACTTTGAGTTTGGCCTACCAAATT
GTCCGGTCGGCAACAAGGGTATTGTGGTCTTTTTCGACCGTTTGATCAAGATGGCTCACTTATCAGCTGTTCCTGACTCAATTGGTGGTGAA