Description :
From Genome Similarity Track
Location :
scaffold_1819:2- 1887
Transcript NameFunction/comments
g11712.t1 hypothetical protein PHYSODRAFT_258359

Sequence
1885 bases(100 bases per row)
GCTAACGTGGACGAGTTCCCAAAGTTCATGGCGGACCGTGCGTCCGTGGAGGCTTGGCGCCAGACGTTCACGCTGTACATCGGCGAGGTGGAGGGCGAGC
CGACTCCGGGTTTCCTTGGATTGTATCCTGGTCTGTAAAGACATCAGTACGTAGACTACCGCTAAAGCACAAACGAATTGAAGTTGTATTCGCTACTTTC
AGGTTTCGAGCTGATAATAACTCAAAATTTACTGTACGTTACTTAAGTACGGTGCTTGTCAAACGATCTACAGACCAGGGTGAACGCCCAGGTATCCGGG
CGTCGGCTCGCCCTGGACTTCTCCAAAGTACAGCGCAAACGTCTGCTTCAGTGCCTCCACCTTAGTTCGGTTGGCCATGAACGTAGGGAATGCATCCAGG
TTGGCCTCAGGGATCTCCCACGGGTGGCTCGATCCCGACGGGGCAATGTCGGTGCGCACAGTCTCCATCACCACCGACTGCTGCACTTCCGTAGACAGAA
TCCAGTTCGTGAACAGCTTGGCAGCCGCAGGGTTCTTCGCTTTGTTCAGAATAGCGAGACGCTGACCCCACGTCAGGTATTCCGTGCCGTTGCCACCTAC
GTACGTGATCGGAGGAGCACCAGCGTACGTGCCGACACCGATGACCTTGTCCTGCGCAGTGACCAGGTTGTTGGCGACGTGGGAGCCACGGTTGAAGCTG
ATACTTTGGTTGGCCATAGCAGCAGCCCATTCCCAACCGTACTGCTCCACATACAAATGGTACACGAACAGCACAGCATCGTCATCGTGAGGGTACGACG
AAGCGATCTTGCCAGCCCATAGAGGATCAACTAGATCAGCCGGAGACGTCGGGGCATCCAGTCTACCGAGGTTGCTCGAGTCGTAGATGTAGCTGAACGA
GTTGACGCCGTACGCGAACCAGGCGCCATTTTCGTCCTTGAGACTATCGTAGATCTTGGAGAAGTTGGCGGGTTTGTACTCGAGCAGGTCGCCCGCGCTA
GCCCAACGGGGGAAGTTCTGCACGGTCTGCAGCGCCGTGATGTCGGGGACGAGCGTATCGGTTTCAAGCTGGTTGTCGATGCGCACGTCGTGGTACTTGC
TGTAGTCGACGACCATGGTCATGTTGATTCCAGGGAAGGCTTCTTCGAACGCTTCCTTTAGCGAGTCTTGCTGGTTCGCGAGGTCACCTCCATGGTAGAA
AACGAGCTTACCGCCTTCAGCAATTGCGTCTTCGTAGAGTTCAGCAAGCGTCTTGGTCTCTTCTTCGACAGCGCAGGCACTCGAAACCACGAGGGCGAAT
ACAGCGGCGAATGGTGCGAAGAGTTTCATCGTCGTATTGGATAGGAAGGTTGAACTGGGAGGCACCCGTCGATTTGGAGAATGAAGTACATGTACCAACT
CATCGAGACCCGCTCGGATGGTGAGCAACCTCCTTTGCGGTGGCGACTAGCGCCATTCCTTGGACAGATCTGCAGATGGATCTCGCGAAAGCACGAAACC
CGACATCTGATAAAGGATAGGCAAGGAGACCAGACTCTGGTCACCAGAGTCTAAGTTGGCGATCTGTTGTCTGTGCAGGAAGTGACGTGACCCCCACGCA
CGTTCAAGATTTGAGGTTGAATGGCTTTCTACAACGTACAGTGCCTGCATTCAACTTGTCCGGTGACAACTTGTCACTGACAAGTAAGCGTCCGAAGAAC
TGTTAGAAATCTAGCAACTCCATACAACAAGAATGCGGTGTGTTGATGTTTCCCAACATTTTGTTTTGTTTTCATTCAGGTACATCGATGTCACTTATCT
TAACGTTTGTGCTAACGACGATGTTTCCCAACATTGCGTGAAATTGTCTTTGCATTGCTTCACACGTCTCAAAGTAGTACATGGA