Description :
From Genome Similarity Track
Location :
Scaffold_1073:2- 1871
Sequence
1869 bases(100 bases per row)
TGTTCGGATCTGATCCAAAGCCATGCGATACATTCGGATCGCTGTGGGAGACTGCTGTTGTTCGAAGTAAATGTTGCCCATATTCACTCTCAATCGACCG
CCCTGTGCGTACTGTTTGTTCTTGACGATCGGTGTATGGAACTCACATCCGGAGGCGGCGAAGAAATGGCGAACGCCATGGAGCACCGCCATGATGGAGG
CGCTACGGATGGGACCGCCGGATCCAAAGCCAAACTGAAATCCATGTAAAACGAAATCCGATATGTGCTTCACCATATCAGTGAGAGTCATGCCATGAAA
CCAGGGAGAAAGTCCTCGTCGCGAAGTCCACCTTTTCCACTTGTTGAAGGCTCGATTGTATTGATCAAACGTGGAGTCGGCAACGGAGTGCGCGCGGAGA
TATGCTGCCAGATACTGGCTAGGCCTTGAATGTCCGTCTTCGGGGCCACCTGCGACCACCCATGTGTTAGCGAAGCAAACACAGCTGCAAAAGATGGGTT
AGCGGGAATACGGGAGCCGGCATCGGCGCGCGTATTATCTGTTCCAGCGACGTGAGACGCTGAAAACCGAAGCCGATATGATGCTTCCCACCAGCTAAGC
AGGCGGATCATCACTTGAGCCCTGGGGTTGCGTGAGGCCAGCTTGTTTTGCCATGCGACAGCGGATGAATTGTCGATACGGAAGTGCACGTGCCGCGGTC
TGTTGCCGATGGGGCTGCTCGCGGACCATCGTTCTCCCCAAGCGTGCACCGCGAAGGCACACGAGAGGAGCTCGCGGAAGTTGATGTCAAAGCCGTTGGC
CGCTCCCATTTTGAATTCCGCTATCAGCGATAGCTCGGATAAGGTAAATGCGTAGGTGAGCGCAGTCTTCGCCAATACGTCAAGCGCACACAGCCCGACA
TCCGACGCGTCCATTTCGACCACAACATCCGGGGGTGGGAGAGCGTTGAAGTATTCCAGAGATACACCGTTTAGCTGAGGGCTGTGCAGAATAAGCCACC
ACCATAGCAGGTCTTCTCGCATTGCGTCTGTCACGGAGACGCCCTGAAAACGATGGAGTTGTGCCTCACGGTGGCGGAGACGCTGAAGGAACGGTCGTGC
GGCCCGAATGCAAGTCGCCACATGACGTAAGCTGCCCATTAATGACCGATACGCTTTTCTAGTCAACGTCGGGGAGTGGTAAGCTGAAGCGACAATCCTG
CGTGCCTTTTGGATCTTGGAAACCGGTAGTGCGACCACTCCATCGACTGAGTCGAACTCCAATCCGAGAACGCGCTGGCGTGTCTTCCAATCAGTGAACT
TCTCGCTGTTGATGGCGTCAGCGCCCAGAATGGCCACCATTGCGTAACGGAGGGAGCGGTCTATGTCGGAACAGGTCGTTCCTATGTCTGCAGCTACGTT
AATGTGGTCATCCACCCAGTGATAATTGAAGAAACCGGCCGGAGAAGCTGCGTTGGTATGGCAGCCATGAAAGTGGGAAAATCGCTCCGCCGAAAATCTC
GTAGAATCCCGGAGAGCCTGTCCATCCGAAAGGCGCGGAAAGCTCGATCACCAGGGCGTTCTCTTCCTCGATCAGCCCGGCAAACAGGTAGACGCTGTTG
CTGTGGATGCTAATATTCCGGAAGGCTGTAGCGACGTCGCCCGCCATCACATAGATTGGTACATCGGGGAATTCTTGCTTTGCTTTCAGGATCTCCCGTG
CTACCGCGTCGCAGTGGATGTAGTCAGGTTTGGTAATGCTGTCTTGATCGGTGCAATCGTTAATCGATGTTCCTTCAGGATATGACAGATCGTGGATCGT
ACGTCCGGAAACCGTGCTGTCCTCGCTTCCCTTGTCCACGACGCCGAAGGGACTAATGATTATCTCTGG