Description :
From Genome Similarity Track
Location :
Scaffold_13:2- 1854
Transcript NameFunction/comments
g18290.t1CAI72292.1 putative polyprotein [Phytophthora infestans

Sequence
1852 bases(100 bases per row)
CCAGCTTGCACATCATGTGTTCCGCGTTTAGGATGCCGTACGGTACCTCCATGAAAACTTGTTCCTTCAAGTCACTGTTCAGGAACGCTGTGTCCGCGTC
CAGCTGCTCTGTGACGTAGGCCTTCGCCACCACCACCGACAGCACAACTCTGATCGAGTTCATGTTGGCGACGGGCGAGTAGGTCTCGAAGAAATCCACG
CCGAACTTCTGCTTGAAGCCCTTCGCCACCAACCGGGCCTTGTACCGCACGACTCTGCCGTGCTCGTTCCGCTTCTTGGCGAACACCCATCGGCACCCAA
TCGGCCGGGCGCCAGACGTCCGTCGAACCAGAGTCCATGACCCGTTGTCTGCGTGCGCCTTCAACTCGGAGTTCATCGCCTTGATCCATTTCGACGCCTC
GTTGCTCTTCATGGCCTGCTGGTACGTGGTTGGCGCGTCGTCGGCGTCTCCCACACTGGCAGCGTAAGCTAGGACAGCTTCAGCGAGAAGCCCGTCCTCA
TCAACTCGAGCCCTCTTAGGCGACGGCGGCCAGAAGTGGTCGTCGTTATTGGGGTCTTCCTCGTCGTTGACCTTGTACTCATCTTCGAGAGCAAGTATCA
GATCACGTGGACGTCGGACTCGTTCACGTTCTGGGTGGAAGACGAGGTCGTCACTGAAGTCTGCCCCCGGCGTCGTTCGGTATGTGGTCAACCCATGCCT
CATCGAGTCGTCCGACTCGGCCTCGGGCATTGCTGCGTCTTCCTCATGGTTATCCTCCACCGATCCCACCGGTGCTTGAGTAGCGGACTGTTGCTCTTGT
TCGAGCTGTACGACTTCATCGACGTCCTCCGTCGAGTGGATGTCTGTCGTGCTCTCCGTCGGCGTCGATTCGTAGATGCCGTCTACCTCGCGCTCGTCGA
GTTTCAGCGACCTGGTCACCTTCACCTTGTTCGACTCCAAGTCGTACACGCGATAGCCCTTTGAGTTCTCGGCGTACCCCAAGAACATGCACTTGAAGCT
CTTCGGCTCCAACTTGGTACGCTTTGCCTTGTCGACGTGGGCATACCCGACCGAGCCGAACACGCGCAAGTGGTCCAGCCGCGGCTTGTCCCTGAACGCC
AACTCGTGCGGCGTCATGCTCGAGTGCGTACTGGTCGTTGACCGGTTGATCAGGTACACCGACGTACTGACCGCCTCGGCCCACCACATCGTCGTGATGC
CCTTGTAGTACAGCATGCTCCGCGCCTTCTCCATGATCGTGCGGTTCATGCGTTCCGCCACGCCATTCTGCTGCGGGCTGTAAGGGACGGTCTTCTGGTG
AACGATCCCGTTCAACGCGCACAACCTGTCCATCTCCTTGTTGACGAACTCCGTGCCGTTGTCCGAGCGCAGGCACTTGATGCGCTCTCCCCATTGGTTC
TCGTACAAGTTCATGAACGTCTTGAACTTGACGGGCACCTCACTCTTCTTGGTGATGAAGTACGCCACAATGTACTTGGAGTAGTCATCCACAAACGTGA
GCACGTACCGGGCCCCGCCCTTAGACTTCGTCTTCATGGGCCCCATGACATCCGTGTGCACCAACTGCAACACCTTCGTCGTCTTCGACAGCGATCGAGA
CGGGAAGTGGGCGACTGTCTGCTTGCCCTTCATGCAACCCCCGCAGATCGTCATGGACTTGTGGTCCAACGTGGGCATGCCAGTGGTGGCGCGCTGCGTC
TTCGCCAGCGCGTCCTTGTTCAAGTGGCCCATGCGCGCGTGCCACAACTCCCACTCACTGTCAACTCCGGCGTACTCCACGTAGTGCGCCATGTCCTTCT
CGCAGTCAAGCATGTAGGCCTTGCCGACCTTCTTGCCCAACGCGATCGCCTT