Description :
From Genome Similarity Track
Location :
Scaffold_3011:2- 1851
Transcript NameFunction/comments
Phyag_g12971hypothetical protein

Sequence
1849 bases(100 bases per row)
TCTCAGCGAATGGCGCGCTGGctgtccttcttcgccgagTATAACTTCGTTGTTCACTACAAGCCCGGCAAGAATAACATCCTTGCCGATGCGCTGTCTC
GCCGTCCAGACTACGACCCGAGCCGCGATCTTGGGCATCAGGTGCctgatgacgaagacgaagatgaatgTTCGTGCTCCATCGCGCGGGGCATTAACGC
GACGGTATCGACCCCTGTGTCACCACTCCGCCAGTAGATATCCGAAGCATACAAAGCTGACCCCTTATACGCGGACATCATCGCGCATCTCCGGAATCCC
AACGCTGAGTCGTTGAAGAAGCTAACACGACCGACACGTGACGCTATCGGGCGCTACCGGCTCGACGACACCCTGCTGACGTATACGATGGACGCGTTCG
ATTCCCCGCGCGTCGTCGTTCCTGCCGATGACGACCTTCGCGCGCGTTTGGTCCACGAATATCACGACGCTCCCGTCGCCGGCCATCTCGGTCGCGAGAA
GACATTCGCCGCGCTTTCCCGAGATTTCTTCTGGCCTAGGATGTACAAGTGGGTACGGAAGTGGATTCGTTCCTGTGAGTCCTGTCAGCGTGTCAAGCCC
TCGCCTTCGTCACAGGCTCCCCTGCGGCCGCTCCCAATTCCCACAGAGGCCTGGCACTCTGTCAGCATGGACTTCGTGTTCGGACTACCCCCAGACGACC
AAGGCCGAACTGGCGCCTTGGTTCTTGTCGATCGATTCAGCAAAATGGTCCAttttgctgcagtcgctgcccATGTGACGGCAGAGGAAACGGccagcct
cttcctcgaaaTCGTATTCCGACATCATGGCCTACCGGAATCCATCGTGTCCGATCGTGACCCTCGCTTCACGTCCGCGTTTTGGGATCGCctctttgag
ctgcttgtgtaacagggttacacaggctggtgtaattgggtacaccagatatacgtgtatacccggactatacacggacaagtatacggcaagccttctg
tgtgtgcgtcacatacacagtcaacaatcatttcgagccgccaatggCACGCANaagtctaagtaacttacgcttcctcaaaagcgcatactagtgtatg
ctaaagaaacagagcgcgtctcgccctgtttcagctTGGAACGCGTCTTCTCATGTCAACGGCGGCCCATCCGGAGACGGATGGGCAGACAGAGCGGGTT
AATCGCGTCCTCGAAGACGTACTGCGTAGTTACGCAACGTCCTTCCAGTCTTGGAGTTCCTTCCTGCCGATCGCAGAGTTCGCCATTAACAATGCAAGCC
ATGCGTCGACTGGCCTGACTCCGTTCTTCGTCAACAACGCGCGCCATCCACGCGTCCCAGCGCTGCTCGGCTTGGCCACGTCTTCGGATCGTATGGGCTC
CACTCTTGGTGGGGGAGAAGATGATCGCGCACCGAAACGTTCTGCGCTATTGCagagtgaagacgacgacttGCTGACACTGGTACCTAGTACCAGTGCC
GAAGCGGCGAACGGGATTTCGTCGAGGACACGCTCGAAGACTATATCCCCTGTGGCCACAAGTCTCGCGCCTGACGTGACGCATAGCGTCACGTCGCCCG
TGGCTAACTTCGCTCCAAAAGCAGATGCAACCCTGATCGACTCCGCAGCAGTGTCGGAGTTTATGTTACAGCGCCAAGCCGTCACGCATTTTGTGCGTGA
CGCGCTGCAAGCAGCCgtggacaagcagaaggaaaATGCCGATAAACGAGGTCGGAAGAACACCTCTGTCTTCCGACAAGGCGATCGAGTACTATTGTCG
ACCACCGGAATCCAGTCGTCGGCAGTGACTAACCTGGGTGCAAACAAAT