Description :
From Genome Similarity Track
Location :
Scaffold_3210:2- 1759
Sequence
1757 bases(100 bases per row)
CCAATGGGTGGATTCCGACGTAGACGGAAGGAGGAAACAAGTCTGTTACCAGGAAGGGCGGAGATTTACACCCCCGGGGATCTCGAGAGATGGGCCTGGG
CGGTATTCCCGGAGTTACCACTGGACCACAGAGGGATGTCCACGATTGACGGATATCCAAAGTGGATCCAGGGGGCAACCGAGCCCGCGGGAAGTGGATC
CGCTTACGTCAGAAAATCTGGGAAAAGCCGACATCCTGCTAAATGGTAAAGGTAATGCATTGCCGCCCGCTGCCCGCGGGAGTCAAATGTGACATCGATG
TCGACGACGCGAAACCGATCGCTCAAACCTGAGATATGTGTCAGTGGGATCCCGTCGTTACAAAGAATGACAGAATCTGGCGTACGAGGCGACTACCGAG
ATCGAGTCTCTCGGAGAGGCGGAGCTCCCGGCGGGCCAACTGGGCCCTTGGTGGATCGGCCTTCATAACCAACTCCGCGAGAGATCCTGCAGAGGGATCG
TCGGATGGAGGTCCAAGCGATGGAGGTTGGATCCAAGATCAGGGATGATCCCCAGAGTCGGCCCCTAGATAACGCAGGGTCGGTGGATGAAGGATCGCAG
AAGGCTGAAGCCGGACCGCCAGATCCCGCTGACCCCTGAGTGGATCCTAGCTTTTCATGGGGCAAAGTGCCTGGATCCTTATCGAGAATAGCAACACTAG
TCAAACCAGAACCGTCGCGTCTAAACTCGCTAGAGGACCGACTAGATCCAACTGGTGGCTTCTCTGATGCCAGGGTACCTGATCCCCCGAAGACAGAAGG
ACGGCCAGGTGAAAGCGGGTTGCGGTGCTTGGATCCAATGGTGGATCCGACGAAGACGGAAGATGAACAAGTCTGTTACCATGAAGGCGGGGATCTACAC
GCCGAGGATCTCGGGGATGGCCTGGCGGTAATCCCGGAGGTACCACTGACCACAGAGGATGTCACGATTGACGATATCCAAGTGGATCCAGGGGCAAACG
AGCCCGCGGAAGTGGATCGGTTACGTCAGAAAATCTGGGAAAGCCGACATCTGCTAATTGGTAAAGGTAATGCATTGCCGCCCGCTGCCCGCGGAGTCAA
ATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTATCAGATCTGATTAAGGGCCTG
CTGCAAGCCAAGGTCATCAGTTTCTCAACATCCCCGTGGGCATCTCCGGTGGTAATCATCATCACGAAGAACGGGGTGGATATACGTCTGTGCATTGATT
ACCGGCTAGCTAACGGCCTGACTCGATTAATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGCTCTCT
AGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACATCGTTTGGACTGTTCGAGTGGAACCGGATA
CCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCGATAACGCTCTCTATGGATTCACCCGAATACCGGAACCCCAAAGGGGTGGATCCG
GGGAAGATCATACCGAAGTAGATCTATTTGAGGCAGGAGAGCCAGGGATTCTGGGACCCCGTCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTA
ATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCG