Description :
From Genome Similarity Track
Location :
Scaffold_3468:2- 1731
Sequence
1729 bases(100 bases per row)
CGCTTCCAGCGTTGATCTTGGGTCCCATCCATGCGCCAAATAGAAAGGCGTGTTACTGCGCACTCGATCATGAGCCGTGTTGAGGGCAAACGAGAGGCGC
TCTGCGTACTCGTCCCAATCCTTCTGGTCGACGTCTGCGACGTACATCTTCAGTGCTCGCGTTATCGTCTGCACTATCCGTTCAGCCGTCCCGTTCACTT
GCGGCCGATACGCCATAGTCGCTCGTTGACGTTGTCCGATGAAATTGTTGAACGATCTGAAAAAGTCAGACATGAAGCCTGGCTCTCGATCGTGCCGGAN
TATAAGATCGGGGCAGCGACGGGATGTGGTCCATAGCGATGATCTGAAATGGGTACGTCGCTTGCAGGTTGTCTGGCAACTCACCTCGAAGAGTTGGTCT
CCCTTTTCCAGTCTCGCAGTCTATGCACTGACCAACCTAACGTTGCACACCTTGATACAGTCCCCTCCAGTGAAAATGTGTTTTGTTCCGCTGGTATGTC
CTCCCAATTCCTTGATGTCCACCTTCCAAACCGACAGGGTAATGATGTAGGAagtcttcttgcagcgtctCAGGAATCACCAGTCGAGCAACAAGATCGC
GATCTTGATTCGATTGCTTGGACGGCGGGCAGTAAAACAACAAGGCGgtctcgtcgatctcatAATCTTCAGCAATCTTAGCGCAGATCTTCGCCTTTAA
TGAGGTAAGTTCCTGTACGTCCCCACGCAGATACTGCTTGAGATCATCGATTCActttttcttcgtcttgttccATGCGAATTCGCTCTTCCCTCATTCG
CTGAACTATCTCCTCTTGCAGCACTTCTGGACTGCGCCGCTTGCGCGACCTTGTCACGGCCGTGATTTTGGTCACAGAACTGTCCGATCGTGGGATCAGC
ATCTCGTCAAGACGGTTAAGCGTCATCAAGGCTTGGAACGCTTCCTTCGACGTCACTACCGTACCTCCTTCATGCTGAAGAGCGGCGCCGGCAAGTCAAT
CTGCGCTCTGGTTCCAGTCCCGCTTCATATGAAGGAATTCGTGACTAGGCCACGATCTTAAACATTCCGTAGCCTGTTGACGTAGTAATTTTAACCCAGG
TGCCTAGCATTCGATCTCGCCTCACATCTGTCGGATGACCAAATTCGAATCTCCGCAGATAATTAGCCGTCCTCTATCCAGATCGGCCAGACGATCGAAG
CATAGGAGCAAACCGTGGTATTCCGCCTCGTTGACTGTCAAATCGTCCTTGTACTGCGACGCAGCTGAGATCACTTTCCATTCTGGTAGGCTCCACATAA
TAGCGCCAAACACTCCTCAACCTCGCTTTACTCGAGCTGATCCATCGAAGCTGACCACTAGCAGCATTTCATCCGCCTCCACCGTAGGTGGTGGCATGGT
AATTACCTGTCGGGGCTGCTTCATGGGTGCTATCGAAACCAAGATCGCGTCGATCTCTTCACGTGGCATGATGCTCGCAGCCATTACGCCCAGGATCTCG
TCCTCACCTTTGTCGCacttgacgatctccaggGTCCAGCTCGACAGCAACGCGGCCCAGCGGCCGAGTCGCCCTTACAATCCTGAGGAGTGCACTAGCC
ATGCCAACGTGGAGTGCCGAGTCAGCACCTTGACTGATCTCGCCACTAGCTGCGTATAGCAGACATCCAAAATCctgagcagcgcgagaactTCCTTGTC
GACGATTCCGTAGTTGATCTCGTTAGGCT